Labshake search
Citations for New England Biolabs :
251 - 300 of 1482 citations for 3 Acetyl N ethylpyridinium bromide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: The detection of aberrant Scyl1 transcripts was performed by RT-PCR using primers designed to amplify sequences between exon 2 to exon 5 (RT-Scyl1_F21 5’-CGCAGTGTCCATCTTCGTGTA-3’ and RT-Scyl1_R51 5’-CCCGGCAGTTCTGCAGGAA-3’) following the OneTaq One-Step RT-PCR Kit (New England Biolabs, E5315S) procedure ...
-
bioRxiv - Genetics 2022Quote: ... 5’-TTAGAAGAACCGGTCTTCAGTATG-3’ and 5’-CTGTAGGCAAGAAAGCAGAGTATTGTCA-3’) on genomic DNA of pooled or individual embryos followed by digest with XhoI (NEB). Following validation of knock-in ...
-
bioRxiv - Neuroscience 2022Quote: ... primers 5’ caccGGAACAGGCAACATGATTGA 3’ and 5’ aaacTCAATCATGTTGCCTGTTCC 3’ were annealed and golden gate assembled using BpiI (Thermo Fischer) and T4 Ligase (NEB) into s23_U6_scaffoldv2 backbone having BpiI cut sites downstream of U6 promoter.
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was eluted in 17μl of water and further 3’ A-tailed using 2.5 units of Klenow 3’ to 5’ exo(-) (NEB, cat M0212) in 1X NEB buffer 2 supplemented with 0.2 mM dATP for 30 minutes at 37°C ...
-
bioRxiv - Bioengineering 2023Quote: The barcoded FXN region was recovered from the resulting cDNA library or DNA using primers of 5’-TGGACCTAAGCGTTATGACTGGAC-3’ and 5’-GGAGCAACATAGTTAAGAATACCAGTCAATC-3’ and PCR was performed using Q5 2x Master Mix (New England BioLabs) at 25 cycles of 98°C for 10s ...
-
bioRxiv - Cancer Biology 2023Quote: ... Half-hairpin sequences were amplified from the genomic DNA (common forward primers 5′- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTTCTTGTGGAAAGGACGA-3′ and reverse primer 5′-CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTCTACTATTCTTTCCCCTGCACTGT-3′) using Q5 High-Fidelity 2x Master Mix (NEB). PCR reactions were cleaned up using Agencourt AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Cell Biology 2024Quote: ... The mutagenesis primers for the addition of the STOP codon at the end of the MPV17 gene from MPV17-HA plasmid (F: 5’-TAATCTAGAATGTACCCATACGATGTTC-3’; R: 5’-GAGCCGATGTGCCTTCCA-3’) were generated using the NEBaseChanger bioinformatic tool (NEB). The mutation was confirmed and the plasmids were validated using Sanger sequencing (Eurofins Discovery).
-
bioRxiv - Immunology 2024Quote: ... and 1.2 nmol of the puromycin linker (5’-/5Phos/-d(A)21-(C9)3-d(ACC)-puromycin-3’) by the T4 DNA ligase (New England Biolabs) in a 100 µL reaction for 1 hour at room temperature ...
-
bioRxiv - Neuroscience 2024Quote: ... The UNC13A CE was amplified with a forward primer in exon 19 5’-CAGACGATCATTGAGGTGCG-3’and reverse primer in exon 22 5’-ATACTTGGAGGAGAGGCAGG-3’using Q5 High Fidelity Master Mix (NEB). PCR products were resolved on a TapeStation 4200 (Agilent ...
-
bioRxiv - Genetics 2024Quote: RNP was complexed by addition of 1 μl of 10 uM Cas9 with 3 μl of 10 uM gRNA in 3 μl NebBuffer r3.1 (NEB B6003S) and 20 μl DNAse/RNase free water ...
-
bioRxiv - Cell Biology 2024Quote: ... FP: 5’-AGCAAGGCTAGCCAAGACAAGTTTGTAC-3’ and RP: 5’-ACTCACGGGCCCTAGTGGGCAGATCTT-3’ and cloned between Nhe-1 and Apa1 (NEB, Ipswich, MA, USA) sites in TTpl503 [mec4p::Lamp-1::GFP]
-
bioRxiv - Developmental Biology 2024Quote: ... pax9el622 fish were genotyped using primers F3 (5’-TCGGAACAGGTCAGAATAGGA-3’) and R3 (5’-TCGGAACAGGTCAGAATAGGA-3’) and Bsrl digestion (New England Biolabs), producing digested wild-type bands (611 and 186 bp ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 3 µL (12 units) M.SssI methyltransferase (NEB). This solution was pre-warmed to 37°C before addition to prevent interference with dCas9:gRNA binding to the DNA ...
-
bioRxiv - Biochemistry 2020Quote: ... in NEB buffer #3 (New England Biolabs, B7003S) for 30 min at 37°C and then ethanol-precipitated after phenol:chloroform and chloroform extraction ...
-
bioRxiv - Developmental Biology 2020Quote: ... 3 units of T4 DNA polymerase (NEB, M0203S), 1 unit of Klenow Enzyme (NEB ...
-
bioRxiv - Bioengineering 2021Quote: ... 3 μl 10 mM dNTP mix (N0477, NEB), and 3 μl Klenow Fragment (exonuclease-deficient ...
-
bioRxiv - Molecular Biology 2022Quote: ... and dephosphorylated with 3 units rSAP (NEB, M0371) with 6 μl CutSmart Buffer (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... 3 μL USER Enzyme (NEB, Ipswich, MA, UK) was incubated with size-selected ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... Then 3 μl USER™ Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 U WarmStart RTx Reverse Transcriptase (NEB, #M0380S), 0.2 μM F3/B3 primers ...
-
bioRxiv - Genetics 2020Quote: ... supplemented with 3 ul Proteinase K (NEB, P8107S). Samples were incubated for 1 hr at 56°C ...
-
bioRxiv - Genomics 2021Quote: ... using Large Klenow fragment 3’-5’ exo- (NEB).
-
bioRxiv - Genomics 2023Quote: ... and 3 µl of Exonuclease I (NEB, #M0293L). The mixture was then incubated at 37°C for 1 hour at 900 r.p.m.
-
bioRxiv - Microbiology 2022Quote: ... and then 3 µl USER Enzyme (NEB, USA) was used with size-selected ...
-
Autorepression of Yeast Hsp70 co-chaperones by intramolecular interactions involving their J-domainsbioRxiv - Biochemistry 2024Quote: ... SIS1VR 5’- CCAATCTGTTCGCGGTGAGCCTCA-3’) by Gibson Assembly (NEB). All constructs were confirmed by sequencing.
-
bioRxiv - Genomics 2023Quote: ... 3 μL 1:1,249 diluted Fe2+ solution (NEB)) at 37°C for 1 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... by using Klenow Fragment (3′→5′ exo-) (NEB) for 30 min at 37 °C and purified by QIAquick PCR Purification Kit ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3 µl of T4 polynucleotide kinase (NEB, M0201L) and 4 µl of terminal deoxynucleotidyl transferase (Enzymatics ...
-
bioRxiv - Molecular Biology 2022Quote: ... rRNA 3’-ends were dephosphorylated using rSAP (NEB) and ligated to either the Universal miRNA Cloning Linker (NEB ...
-
bioRxiv - Microbiology 2024Quote: ... 3 µL volume of USER Enzyme (NEB, USA) was applied to the size-selected ...
-
bioRxiv - Immunology 2024Quote: ... and T4 PNK 3′ phosphatase minus (NEB, M0236L) at 37°C for 10 min ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 3 µl 1,000 U/µl USER Enzyme (NEB), Ultrapure water (Thermo ...
-
bioRxiv - Plant Biology 2024Quote: ... A-tailed with Klenow 3’-5’ exo-(NEB), and truncated Illumina adapters were added with T4 DNA ligase (NEB ...
-
bioRxiv - Bioengineering 2024Quote: GGATCC-3’ and 1x ThermoPol Reaction Buffer (NEB), 10 units of Taq DNA polymerase (NEB) ...
-
bioRxiv - Bioengineering 2024Quote: ... and 3 μL 10X rCutSmart buffer (NEB, B6004S) incubated at 37°C for 10 min and heat inactivated at 80°C for 2 min ...
-
bioRxiv - Bioengineering 2024Quote: ... for fragments <3 kb and Q5 (M0492, NEB) for fragments >3 kb ...
-
bioRxiv - Developmental Biology 2024Quote: ... 3’ exonuclease activity of Klenow polymerase (NEB M0210) was done also at 37 °C for 30 minutes while shaking ...
-
bioRxiv - Molecular Biology 2021Quote: ... together with an N-terminal FLAG-emGFP-tag via NheI and NotI (both New England Biolabs) restriction sites ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5’ adaptor (rGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCr-GrArCrGrArUrCrNrNrNrCrGrArNrNrNrUrArCrNrNrN, N is for a random nucleotide) by T4 ligase 1(NEB) sequentially ...
-
bioRxiv - Microbiology 2021Quote: ... Plasmids from O/N cultures were extracted with the Monarch Plasmid Miniprep Kit (New England Biolabs) and sent for sequencing to LGC genomics.
-
bioRxiv - Biophysics 2022Quote: ... The human μOR and V2R were amplified with a SNAP tag at their N-terminal (NEB) and subcloned in the pcDNA4/TO plasmid (Invitrogen) ...
-
bioRxiv - Immunology 2021Quote: ... 2 µL of random primer mix 60 µM (cat. n° S1330S, NEB, New England Biolabs, USA) and 4.8 µL of nuclease-free water ...
-
bioRxiv - Immunology 2021Quote: ... 0.2 µL of RNase Inhibitor 40 U / µL (cat. n° M0314L, NEB, New England Biolabs, USA), 1 µL of ProtoScript II reverse transcriptase 200 U / µL (cat ...
-
bioRxiv - Immunology 2021Quote: ... 2 µL of random primer mix 60 µM (cat. n° S1330S, NEB, New England Biolabs, USA) and 4.8 µL of nuclease-free water ...
-
bioRxiv - Immunology 2021Quote: ... 0.2 µL of RNase Inhibitor 40 U / µL (cat. n° M0314L, NEB, New England Biolabs, USA), 1 µL of ProtoScript II reverse transcriptase 200 U / µL (cat ...
-
bioRxiv - Cell Biology 2022Quote: ... enzyme digestion or Peptide-N-Glycosidase F (PNGase F) (New England Biolabs, Ipswich, MA, catalog #: P0704L) enzyme digestion was performed according to manufacturer’s instruction and the published procedure [49].
-
bioRxiv - Plant Biology 2020Quote: ... were PCR amplified using Q5® High-Fidelity DNA Polymerase (New England Biolabs, Cat n° M0491) with oligonucleotide primers containing attB recombination sequences ...
-
bioRxiv - Immunology 2021Quote: ... the uridines present in one cDNA strand were digested with uracil- N-glycosylase (New England BioLabs), as described 67 ...
-
bioRxiv - Biochemistry 2023Quote: ... or β-N-acetylhexosaminidases (jack bean from Sigma-Aldrich, Streptomyces plicatus chitinase from New England Biolabs or in-house-produced recombinant Caenorhabditis elegans HEX-4 specific for β1,4-GalNAc-linked residues ...
-
bioRxiv - Biochemistry 2022Quote: ... CBP (Chitin Binding Protein, produced by N. Martín in Dr. Casanova’s lab, New England Biolabs Protocol) was used as a secondary antibody at 1:300 to detect chitin and visualize the tracheal branches ...