Labshake search
Citations for New England Biolabs :
251 - 300 of 4948 citations for 3 2 5 Dioxoimidazolidin 4 yl propanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... and we amplified mEmerald including vector sequence but omitting the mitochondrial targeting sequence from the mEmerald-Mito-7 plasmid using primers mEmeraldVector forward (5’ TGGATCCATGGGGGATCCACCGGTCGCC 3’) and mEmeraldVector reverse (5’ ACACCGACATGCTAGCGGATCTGACGGTTCAC 3’) and combined the fragments using a HiFi assembly kit (New England Biolabs, Ipswich, MA) to create a plasmid expressing CHMP4B-mEmerald ...
-
bioRxiv - Biochemistry 2023Quote: ... primers “frq segment 2F” (5’-GTGAGTTGGAGGCAACGCTC-3’) and “frq segment 2R” (5’-GTCCATATTCTCGGATGGTA-3’ were used for PCRs in combination with pCB05 digested with XhoI (NEB, Catalog # R0146S) to NruI (NEB ...
-
bioRxiv - Genetics 2023Quote: ... PCR-derived DNA fragments were generated by pairing oWS1359 (5°-TATGATTCCGATGAAGAAGAACAAGGTGGCGAAGGTGTACAATGT-iTriMix20-iTriMix20-iTriMix20-TGATTTTCTTGATAAAAAAAGATC-3°) and oWS1308 (5°-CAGCATATAATCCCTGCTTTA-3°) and pWS1728 template using a high-fidelity Q5 polymerase (New England Biolabs, Ipswich, MA). The PCR products were purified (Omega E.Z.N.A Cycle Pure kit ...
-
bioRxiv - Genomics 2021Quote: ... DNA samples were incubated with 50 μM dATP and 5 U of Klenow Fragment (3’→5’ exo-) (New England Biolabs, M0212) in 30 μl 1 × NEBuffer2 at 37°C for 30 minutes.
-
bioRxiv - Immunology 2020Quote: mRNA capping reaction was performed with purified IVT mRNA using 3’-O-Me-m7G(5’)ppp(5’)G RNA Cap Structure Analog (NEB, USA). The reaction condition was followed according to supplier’s manual ...
-
bioRxiv - Molecular Biology 2022Quote: ... DNA was transcribed into mRNA which was co-transcriptionally capped with the Anti-Reverse Cap Analog (ARCA) 3′-O-Me-m7G(5′)ppp(5′)G (NEB # S1411) using the HiScribe T7 High Yield RNA Synthesis Kit (NEB # E2040) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Single turnover reactions were carried out as follows: 5 µM Clr4 was preincubated 5 minutes with 1 mM final S-adenosyl-methionine (liquid SAM, 3 2mM, NEB #B9003S), and varying concentrations of pSwi6 or unP Swi6 ...
-
bioRxiv - Microbiology 2022Quote: ... aliquots of 200 ng nucleic acid were treated with 2 U DNase I (New England Biolabs), 10 U S1 nuclease (Thermo Scientific) ...
-
bioRxiv - Molecular Biology 2024Quote: ... To digest sialic acid: 2 μL of α2-3,6,8 Neuraminidase (50U/mL, New England Biolabs, NEB) with GlycoBuffer 1 (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... To digest sialic acid: 2 μL of α2-3,6,8 Neuraminidase (50U/mL, New England Biolabs, NEB) with GlycoBuffer 1 (NEB ...
-
bioRxiv - Genomics 2020Quote: ... with 2 μl (5 U/μl) of Klenow fragment exo- (NEB) in a final volume of 55 μl by incubation at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µM HDVLig (pre-adenylated using a 5’ adenylation kit (NEB)) ...
-
bioRxiv - Biophysics 2023Quote: ... and 5 U Klenow in 1× NEBuffer 2 (New England BioLabs) (120 μL total volume ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µl Klenow enzyme (5 units/µl, New England Biolabs, M0210S), and 3 µl 10 mM dNTP (KAPA HiFi Kits from Roche ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 μl Hot Start High-Fidelity 2× Master Mix (M0494S; NEB) and nuclease-free water to fill up to 10 μl ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 mM MgCl2 and 2 μL (10 U) RNase H (NEB, Cat# M0297S) in order to digest poly(A ...
-
Expansion of gamma-butyrolactone signaling molecule biosynthesis to phosphotriester natural productsbioRxiv - Biochemistry 2020Quote: ... 5’-gaattcgatgtgtaggctggag-3’ using Gibson assembly technique (kit was purchased from New England Biolabs), to yield pIJ773-Δspt9 ...
-
bioRxiv - Biophysics 2020Quote: ... and 7U/mL Klenow Fragment of DNA Polymerase I (3’-5 exo-) (NEB, M0212). Reactions were incubated at 37°C and incorporation of labeled dCMP was monitored by an acid precipitation assay ...
-
bioRxiv - Biochemistry 2022Quote: ... and then incubating with either Klenow Fragment (3’→5’ exo-) (New England Biolabs (NEB), M0212L ...
-
bioRxiv - Biochemistry 2022Quote: ... and then incubating with either Klenow Fragment (3’→5’ exo-) (New England Biolabs (NEB), M0212L ...
-
bioRxiv - Developmental Biology 2020Quote: ... act57B sequence: 5’-UCUUCCCCUC-3’ RNA oligonucleotides were end-labeled using T4 Kinase (NEB) with ATP [γ-32P]32 ...
-
bioRxiv - Genomics 2022Quote: ... the end-repaired DNA was mixed with Klenow Fragment (3′ → 5′ exo−) (NEB, #E6044A) in NEBNext dA-Tailing Reaction Buffer (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... and then 3’-end dephosphorylated and 5’-end phosphorylated using T4 polynucleotide kinase (NEB). tRNA library preparation used SuperScript™ IV following the QuantM-tRNA-seq protocol (Pinkard et al ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 mM MgCl2 and 4 units of RNase Inhibitor Murine (NEB, M0314). After 30 min at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... was designed with 4 nt 5’ overhangs that match 5’ overhangs of the pCsm vector left by linearization with BbsI (NEB). 10 pmoles of each oligonucleotide set were annealed in 1X CutSmart buffer (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: A 2-fold excess of either m7G(5’)ppp(5’)G RNA Cap Structure Analog (New England Biolabs) or chemically synthesized cap4 hexa-nucleotide (see cap4 synthesis below ...
-
bioRxiv - Microbiology 2021Quote: ... The digested DNA (4 ml in total) was split into 4 aliquots and diluted in 8 ml ligation buffer (1X ligation buffer NEB 3 (without ATP), 1 mM ATP ...
-
bioRxiv - Cancer Biology 2020Quote: ... A 3’ A overhang was added to the ends of the blunted DNA fragment with Klenow Fragment (3’-5’ exo; NEB; Cat. No. M0212L). The DNA fragments was then ligated with diversity-increased custom barcodes (Shi et al. ...
-
bioRxiv - Genomics 2024Quote: ... 2 μL of 10% Tween-20 and 5 μL NEBNext High-fidelity 2× PCR Master Mix (NEB, M0541) was added to each well sequentially ...
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were centrifuged for 5 minutes at 5000rpm at 4°C and supernatant treated with 5 mg/ml of proteinase K (New England Biolabs #P8102) for 1 hour at 50°C ...
-
bioRxiv - Plant Biology 2021Quote: ... for 3 hours at 55°C and M-2 was digested with XhoI (NEB) overnight at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA was ligated with 3′-adenylated adapters using T4 RNA Ligase 2 (NEB #MO351) for 4 hrs at 16°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µM IllLigBio adapter pre-adenylated using a 5’ adenylation kit (NEB), 20-200 nM pppUGAAUG hexamer standard ...
-
bioRxiv - Microbiology 2023Quote: ... 2 μg 5’PPP transcripts were incubated with 10 U RppH (NEB) and 20 U RiboLock (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2023Quote: ... 2 μL 1 M CaCl2 and 5 μL micrococcal nuclease (NEB, #M0247S) were added and chromatin was fragmented into predominantly mono-nucleosomes by incubation at 37°C for 15 min ...
-
bioRxiv - Developmental Biology 2021Quote: ... with subsequent end repair/dA-tailing reaction using Klenow Fragment (3’-5’ exo-) (NEB M0212S) and ligation with Illumina sequencing adapters using T4 DNA ligase (NEB) ...
-
bioRxiv - Genomics 2021Quote: ... The ligation mix (5 μL of LNB, 3 μL of Quick ligase (New England Biolabs), 1.2 μL of MQ ...
-
bioRxiv - Pathology 2021Quote: ... The second strand was synthesized with Klenow Fragments (3′-5′ exo-; New England Biolabs Inc.) and complement chains of NSR primers ...
-
bioRxiv - Molecular Biology 2020Quote: ... containing 0.1 mM dATP and 15 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M) and incubated at 37°C for 30 min ...
-
bioRxiv - Microbiology 2022Quote: ... CrPV 5’UTR-1A-GFP-3’ UTR was generated using Gibson assembly (NEB Gibson assembly). The respective mutants were generated using Site directed mutagenesis ...
-
bioRxiv - Molecular Biology 2020Quote: ... 240 μM TruSeq Universal Adapter (5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’) and 0.025 U Taq DNA Polymerase (NEB) in 1X Standard Taq Reaction Buffer (NEB) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 2.0 units of Klenow Fragment (3’-5’ exo−)(New England Biolabs, Ipswich, Massachusetts, USA), total 10 μl of the mixture was incubate at 37°C for 90 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... Small RNAs were 3’ dephosphorylated and 5’ phosphorylated with T4 polynucleotide kinase (T4PNK, NEB, #M0201S), and purified with RNA Clean and Concentrator-5 (Zymo Research ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and second strand cDNA synthesis (using Klenow fragment 3’-5’ exo- [New England BioLabs, USA]) of chicken fecal samples and dust samples was performed as previously described 55 and following manufacturer’ instructions.
-
bioRxiv - Cancer Biology 2022Quote: ... 3 μg purified DARPP-32 isoforms as well as 5 μl ATP (New England Biolabs) in kinase dilution buffer III (SignalChem ...
-
bioRxiv - Cell Biology 2022Quote: ... A18-Y260A-SDM-Rev (5’-CGTTGTGTAACCAGGAGAATG-3’) and Q5 site directed mutagenesis kit (NEB E0554). This LT3N1-GPIR-Arhgef18 vectors were further modified to substitute EGFP with 3XHA-FLAG tag ...
-
bioRxiv - Cell Biology 2022Quote: ... miRE-Rv (5’-TCTCGAATTCTAGCCCCTTGAAGTCCGAGGCAGTAGGC-3’) and Q5 Hot Start High-Fidelity DNA polymerase (NEB M049S). The final amplicon was then digested and cloned into LT3GEPIR in-between XhoI and EcoRI restriction sites as previously described2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1pmol ssDNA substrate 5’ DY782 ATTATTATTATTATTATTATTTCATTTATTTATTTATTTA-3’ (Eurofins, UK) and 0.75U uracil-DNA glycosylase (NEB) were added to 10µg protein lysate at 37°C for 1 hour ...
-
bioRxiv - Microbiology 2023Quote: ... Nef deletion Reverse: 5’-AGATCTACAGCTGCCTTGTAAGTCATTGG-3’) using Q5® Site-Directed Mutagenesis Kit (NEB #E0554S).
-
bioRxiv - Immunology 2024Quote: ... and 0.8U/µL of Klenow Fragment (3’-5’ exo-) DNA polymerase (NEB, Cat No. M0212M). Nickase induced linear SDA was performed using 3nM (0.04U/ µL ...