Labshake search
Citations for New England Biolabs :
251 - 300 of 7694 citations for 2R 5S 5 4 amino 5 fluoro 2 oxopyrimidin 1 2H yl 1 3 oxathiolan 2 yl methyl butyrate WXC04778 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... at 37 °C for 1 h and ligated to a 3′ adaptor sequence using T4 RNA ligase 2 (truncated K227Q, New England Biolabs) at 22 °C for 3 h ...
-
bioRxiv - Molecular Biology 2020Quote: ... 8 μl 5x PNK pH 6.5 buffer [350 mM Tris-HCl pH 6.5, 50 mM MgCl2, 5 mM DTT], 1 μl PNK enzyme [NEB] ...
-
bioRxiv - Molecular Biology 2021Quote: ... after incubating the samples with 2 μl of RNase A (Thermo) at 37 °C for 2h and then with 8 μl of proteinase K (NEB) at 55 °C for 4h ...
-
bioRxiv - Molecular Biology 2021Quote: ... Entry vectors 1-5 were digested with BsaI (New England Biolabs) and ligated into the pGGDestSC-ATG destination vector (addgene #49322 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 72 °C for 1 min) × 5] using NEBNext 2xMasterMix (NEB, M0541S) with Ad1_noMX and v2_Ad2.* indexing primers followed by qPCR amplification to determine additional cycle numbers ...
-
bioRxiv - Microbiology 2024Quote: ... Ligation of 5’ linker using T4 RNA ligase 1 (NEB; #M0204S) was conducted after phosphorylating the 5’ end of the pooled fragments with T4 PNK (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... 72 °C for 1 min) × 5] using NEBNext 2xMasterMix (NEB, M0541S) with Ad1_noMX and v2_Ad2.* indexing primers followed by qPCR amplification to determine additional cycle numbers ...
-
bioRxiv - Genomics 2024Quote: M13seq primer (5’-GACGTTGTAAAACGACGGC-3’) was labeled with 32P at 5’-end by T4 polynucleotide kinase (New England Biolabs). Primer/template (p/t ...
-
bioRxiv - Bioengineering 2024Quote: ... following the manufacturer’s instructions and 3′-O-Me-m7G(5′)ppp(5′)G RNA cap (New England Biolabs, USA) was used as the cap structure analog ...
-
bioRxiv - Genomics 2021Quote: ... and 4 μl 5 U/μL I-SceI (NEB, #R0694L) in a 50 μL final volume for 3 hours at 37°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 µl T7 Endonuclease I (1 U/ul, M0302S, NEB) was added and incubated at 37°C for 1 hr ...
-
bioRxiv - Genomics 2020Quote: ... 1 µl T4 RNA Ligase 2 truncated K227Q (200U; NEB)] was added ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 1 μl Bst 2 WarmStart DNA polymerase (NEB M0538S) was added and sample incubated 30 min at 65°C before precipitation with 12.5 μl 10 M NH4OAc ...
-
bioRxiv - Systems Biology 2024Quote: ... and 1 μL of Phusion Polymerase (2 U/μL, NEB) were added and mixed by pipette ...
-
bioRxiv - Genomics 2020Quote: ... A-tailing 3’ end was performed using Klenow Fragment (3’→5’ exo-) (New England Biolabs), and then TruSeq Adapters were ligated by Quick T4 DNA Ligase (New England Biolabs) ...
-
bioRxiv - Developmental Biology 2020Quote: ... followed by addition of 3’-A overhangs using Klenow Fragment 3’-5’ exo- (NEB, M0212S). After denaturation of DNA at 95°C for 3 min ...
-
bioRxiv - Cell Biology 2021Quote: ... A-tailing 3’ end was performed using Klenow Fragment (3’→5’ exo-) (New England Biolabs), and then TruSeq Adapters were ligated by Quick T4 DNA Ligase (New England Biolabs) ...
-
bioRxiv - Microbiology 2023Quote: ... 3 μL of 5’ adenylated linkers (Supplementary Table 4) were added (33 pmol/μL) along with 1 μL T4 RNA ligase 2 truncated (New England BioLabs) and incubated at 25 °C for 2.5 hours ...
-
bioRxiv - Molecular Biology 2023Quote: ... Unincorporated ddRTP molecules were inactivated by adding 1 µL of Buffer 2 (80 mM MgCl2) and 1 µL of 1:1 rSAP (NEB):50% glycerol ...
-
bioRxiv - Microbiology 2021Quote: ... and was then installed with 5’cap (Vaccinia Capping System, NEB, USA; Cap 2’-O-methyltransferase, NEB, USA) and 3’ Poly(A ...
-
bioRxiv - Microbiology 2022Quote: ... poly(A) RNA (2-5 ng) was converted to cDNA using the Protoscript II kit (New England Biolabs) and a supplied mix of random hexamer and d(T)23VN primers ...
-
bioRxiv - Microbiology 2024Quote: ... the DNA adenylated oligonucleotide adenylate intermediate was de-adenylated (RNA sample, NEB Buffer 2, and 5’-deadenylase (NEB); incubation at 30 °C for 1 h ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5’-triphosporylated RNA was capped with 3’-desthiobiotin-TEG-GTP (NEB)) using the Vaccinia virus Capping enzyme (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... then free 3 adaptors were degraded using 5 deadenylase (NEB, M0331) and RecJf (NEB ...
-
bioRxiv - Immunology 2021Quote: ... and 375 U/mL of Klenow Fragment (3’-5’ exo-) (NEB). After cDNA synthesis and subsequent purification by AMPure XP (Beckman Coulter) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1.5 µ l of Klenow Fragment (3’→5’ exo-, NEB, M0212S) and 1.5 µ l of T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Genomics 2022Quote: ... and A-tailed using Klenow (3′-5′ exo-; New England Biolabs). Illumina sequencing adapters were then ligated to DNA ends using Quick Ligase (New England Biolabs) ...
-
bioRxiv - Genomics 2020Quote: ... EcoRI-HF (5’ GAATTC 3’) (New England BioLabs Inc., Ipswich, MA). gDNA samples that showed poor banding patterns or could not be digested by the enzymes listed above were then digested with Taq⍺I (5’ TCGA 3’ ...
-
bioRxiv - Genomics 2023Quote: ... and 2.5 U Klenow Fragment (3’ -> 5’ exo-) (New England BioLabs) and H2O to 20 μL ...
-
bioRxiv - Systems Biology 2024Quote: ... and A-tailed using Klenow HC 3′ → 5′ exo (#M0212L; NEB).
-
bioRxiv - Microbiology 2024Quote: ... MBTUni-13 primer (5’-ACGCGTGATCAGTAGAAACAAGG-3’) and Phusion Polymerase (NEB M0530L). PCR products were purified with PureLink PCR Purification Kit (Invitrogen K310002 ...
-
bioRxiv - Molecular Biology 2024Quote: ... dA-tailing was done using Klenow fragment (3′→5′ exo-, NEB) with deoxyadenosine triphosphate (dATP ...
-
bioRxiv - Genomics 2020Quote: ... Nuclei were pelleted at 1,000 x g for 5 min at 4°C then resuspended in 450 μl of 1X NEBuffer 3 (NEB, cat. # B7003S). Primary restriction enzyme digestion of intact nuclei was carried out overnight at 37°C using 50,000 U of DpnII (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... and internal transcribed spacer 4 (ITS4) (5′ TCCTCCGCTTATTGATATGC 3′) primers,27 along with the Phusion High Fidelity DNA polymerase (New England Biolabs, Ipswich). Touch-down method of PCR was used for increased specificity of primer amplification in a Surecycler 8800 (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2-3 ×106 cells were treated with MNase (NEB M0247) ranging from 10-30 Kunitz U in 800 μl of custom buffer (Tris-HCl pH 7.5 10 mM ...
-
bioRxiv - Systems Biology 2024Quote: ... 2 μL of T4 DNA Polymerase (3 U/μL, NEB) 1 μL of Klenow DNA Polymerase (5 U/μL ...
-
bioRxiv - Cell Biology 2023Quote: ... all strains were generated by the S1/2/3/4 homologous recombination PCR integration method (Janke et al., 2004) using a Q5 PCR Kit (NEB). S1-S2 primers was used to knock out endogenous proteins ...
-
bioRxiv - Genetics 2021Quote: ... 2nd cDNA strand was again synthesized using a transcript specific primer (either 5’UTR_βG-intron _F or 5’UTR_CMV _F2, Table 4) and Q5 2x master mix (NEB, #M0494). After another round of bead purification ...
-
bioRxiv - Genetics 2021Quote: ... two complementary oligos containing the guide sequence and a BbsI recognition site (Oligo F: 5’CACCGNNNNNNNNNN….3’ and Oligo R: 5’AAACNNNNNNNNNN…..C3’) were annealed and cloned into the BbsI (NEB) digested target plasmid.
-
bioRxiv - Physiology 2021Quote: ... samples were resuspended in RNAse-free water and ligated to a 5’-adenylated DNA adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′ (M0373, New England Biolabs), for 3 hours at room temperature ...
-
bioRxiv - Biochemistry 2022Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and adenylated using 5′ DNA adenylation kit at the 5′ end (NEB). To reduce a ligation bias ...
-
bioRxiv - Microbiology 2022Quote: ... The 5’-RNA adapter (5’-CCUUGGCACCCGAGAAUUCCA-3’) was ligated to the 5’ end of the RNA using T4 RNA ligase I (NEB). RNA was purified as above by binding to streptavidin beads ...
-
bioRxiv - Molecular Biology 2023Quote: ... Non-IRES mRNAs were capped the 3’-O-Me-m7G(5’)ppp(5’)G anti-reverse cap analog (NEB # S1411L). IRES mRNAs were capped with the A(5’)ppp(5’)G cap analog (NEB # S1406L) ...
-
bioRxiv - Immunology 2024Quote: ... A custom ribonucleoside blend was used comprising 3′-O-Me-m7G(5′)ppp(5′)G cap analog (New England Biolabs), ATP ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and then adenylated at the 5′ end with a 5′ DNA adenylation kit (NEB). Four random nucleotides were added in the 3′ and 5′ adapters [(5′ -rAppNNNNTGGAATTCTCGGGTGCCAAGG/amino CA linker-3′ ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and adenylated using a 5′ DNA adenylation kit at the 5′ end (NEB). To reduce ligation bias ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3’ end filling and dA tailing was performed by Klenow Fragment (3’>5’ exonuclease deficient; NEB). Libraries were prepared by ligation of NEBNext adapters and indexed i7 primers (NEB) ...
-
bioRxiv - Cell Biology 2024Quote: ... Whole brains were blocked at RT for 1 h in PBT containing 0.5% BSA and 5% NGS (PBANG) and then incubated in PBANG containing rabbit anti-GFP (1:100; Torry Pines Biolabs, TP401) at 4°C for 2 nights ...
-
bioRxiv - Neuroscience 2023Quote: ... the coverslips were washed in 2×SSC for 30 minutes for a total of four washes and then stored at 4°C in 2×SSC supplemented with 1:100 Murine RNase inhibitor (New England Biolabs, M0314S) for no longer than 2 weeks prior to imaging.
-
bioRxiv - Genomics 2023Quote: ... cells were then pelleted at 500xg for 2 min at 4°C and then resuspended in 200 μl of 1 × T4 DNA ligase buffer (NEB, B0202S) containing 0.2% SDS ...