Labshake search
Citations for New England Biolabs :
2901 - 2950 of 3392 citations for 3RS 4 Dimethylamino 3 methyl 2 2 diphenylbutanenitrile Isodidiavalo since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... which was digested with Not1 and EcoR1 to accept two overlapping PCR fragments and a 1Kb 3’Arm by Gibson assembly (NEB). Aplnr (NM 011784.3 ...
-
bioRxiv - Immunology 2021Quote: Antisense DNA probes (Table S7) were synthesized at Metabion AG and 3’ mono-biotinylated using terminal transferse (New England Biolabs) and Biotin-11-ddUTP (Jena Bioscience ...
-
bioRxiv - Genetics 2020Quote: ... and T3 (5’-AATTAACCCTCACTAAAGGG-3’) promoter-tagged PCR fragment from each gene using corresponding T7 and T3 RNA polymerase (T3:M0378S; T7:M0251S, BioLabs). Primers used for PCR are listed in Supplemental table 1 ...
-
bioRxiv - Biophysics 2020Quote: ... backbone and insert were mixed at a 1 to 3 ratio (40 fmol in total) in CutSmart® Buffer (NEB) supplemented with 3mM ATP and 10mM DTT ...
-
bioRxiv - Cell Biology 2020Quote: ... pCS2-luciferase CDS or pCS2-luciferase with G3BP1 5’UTR and 3’UTR were linearized with Sal I (New England Biolabs) and gel purified (Qiagen) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 3 µL of the assembly product was used to transform 65 µL of T7 Express chemically competent cells (NEB #C2566I) according to the manufacturer’s high-efficiency transformation protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... Deletions within the nhr-23 3′ UTR reporter (cloned in pHR017) were created using a Q5 Site-Directed Mutagenesis Kit (NEB) and verified by Sanger Sequencing (Genewiz Inc.) ...
-
bioRxiv - Microbiology 2023Quote: ... an ‘A’ base was added to the 3’ end of the blunt-end phosphorylated DNA fragments using the polymerase activity of Klenow (Exo-Minus) polymerase (NEB); Illumina genomic adapters were ligated to the A-tailed DNA fragments ...
-
bioRxiv - Microbiology 2023Quote: ... The library preparation including an enrichment step for 5’-triphosphorylated RNAs by capping the RNAs with 3’-desthiobiotin-TEG-GTP (NEB) [15] and subsequent deep sequencing on a Illumina NextSeq 500 system with 75 bp read length were conducted at Vertis Biotechnologie (Germany ...
-
bioRxiv - Biochemistry 2023Quote: ... were ligated to 50 pmol RNA oligonucleotide “20.25” (5’-UCG AAG UAU UCC GCG UAC GU-3’, Dharmacon) with 1 µL T4 RNA ligase 1 (NEB, #M0204S) for 1 h at 16 °C in 15% (v/v ...
-
bioRxiv - Cancer Biology 2023Quote: ... Endo H digestion was performed at 37°C for 1h in the presence of 1X GlycoBuffer 3 and 1 µL of Endo H enzyme (NEB). The lysates were boiled and subjected to SDS-PAGE and western transfer ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’-TGGCCAGACGGAATCCAATG-3’ and 5’-GTGGTGGGCCACCAAGACGG-3’, and cloned into pX330-P2A-EGFP/RFP (Zhang et al, 2017) through ligation using T4 ligase (New England Biolabs). Nup96-GFP KI U2OS cells were transfected using X-tremeGENETM 9 DNA Transfection Reagent (Roche) ...
-
bioRxiv - Microbiology 2023Quote: ... The 5’ end ligated samples were purified using PCI extraction and then the 3’ App-PE adapters were ligated to the RPF using 40 U T4 RNA ligase I (NEB). The 5’ and 3’ ligated samples were resolved on a 12% TBE-Urea polyacrylamide gel and the band corresponding to the RPF was gel-excised ...
-
bioRxiv - Cell Biology 2023Quote: ... and inserted between Gly118- and Glu119-encoding codons of odr-3 (72) in the modified pMC10 vector using NEBuilder HiFi DNA assembly (NEB). The resulting plasmid sequence was confirmed by Sanger sequencing ...
-
bioRxiv - Cell Biology 2023Quote: ... and primers listed in (Extended Data Table 3) and used for in vitro transcription by T7 RNA polymerase (New England Biolabs). Resulting RNA was purified using a spin-column kit (RNeasy mini kit ...
-
bioRxiv - Biophysics 2023Quote: ... We combined the plasmid backbone with the colony PCR insert by mixing them in molar ration 1:3 in the 2xHiFi mix (New England Biolabs). We incubated the reaction at 50°C for 60 min ...
-
bioRxiv - Developmental Biology 2023Quote: ... and cloned under control of the hlh-3 promoter in pSL780 (Bone et al., 2016) with Gibson cloning (New England Biolabs) to generate pSL814 ...
-
bioRxiv - Biophysics 2023Quote: ... was used.23 The RNA was ligated to a 5ʹ-phosphorylated-Cy3-oligo at the 3’ end of the RNA by T4 RNA ligase (NEB) by following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... 3 µL of RNA from 4 x 96 well plates was transferred to a 384 well plate with 3 µL of master mix containing 1 µL of a 10 mM stock of dNTPs (NEB Catalog# N0447L ...
-
bioRxiv - Molecular Biology 2023Quote: ... Second-strand DNA synthesis was done by ligating 10 µM of a blunt-end duplex comprised of a 32-bp Illumina R1-3’SpC3 and 5’-phosphorylated R1R-3’SpC3 DNA (pre-annealed by incubating at 95°C for 3 min and slowly cooling to 25°C) using a Quick ligase kit (New England Biolabs) according to manufacturer’s protocol followed by clean-up as described above ...
-
bioRxiv - Microbiology 2023Quote: ... we transcribed T7 promoter-pre-Let7c 5’GCTCCUUGGUUUGCTUGUUGGTTGTUCUGTTUUCTCCCUGGGTGTUUCTCTUUU CCUTUCUUCCTUCTUCCTCUUCCCGGUTGCCCTATAGTGTGAGTCGTATTA 3’ and T7-promoter-pre-miR29a 5’ATAACCGATTTCAGATGGTGCTAGAAAATTATATTGACTCTGAACACCAAAAGAAA TCAGTCCCTATAGTGAGTCGTATTA3’ using the T7 high yield RNA synthesis kit (BioLabs) with α 32P UTP (Perkin Elmer ...
-
bioRxiv - Molecular Biology 2023Quote: ... The purified ribodepleted RNA samples were fragmented for 3 minutes at 94°C in Magnesium RNA Fragmentation Module (New England Biolabs) and 3’ ends were dephosphorylated with T4 polynucleotide kinase (Lucigen) ...
-
bioRxiv - Immunology 2023Quote: ... were incorporated onto the mab-oligos via a 50 μl gap-fill ligation reaction consisting of 40 U Taq ligase (New England Biolabds) 3 U T4 DNA polymerase (New England Biolabs), 100 μM dNTPs ...
-
bioRxiv - Microbiology 2023Quote: ... standard curve transcripts and viral RNA in the samples were reverse transcribed with a reverse E1 primer containing a nongenomic tag sequence74 5’-CAGACAGCACTCGTTCGTACAC-3’ through the Protoscript II First Strand cDNA Synthesis Kit (New England Biolabs). The (+ ...
-
bioRxiv - Microbiology 2023Quote: ... PCRs were performed using specific reaction primer pairs specific to the appropriate parental segment (Table 3) and Q5 High-Fidelity Polymerase (NEB) according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... 3 µl of the purified assembly is incubated with 50 µl of NEB 10-β-competent E.coli cells (NEB, C3019H) for 30 min at 4 ℃ ...
-
bioRxiv - Cell Biology 2023Quote: ... Donor sequences were then inserted at the HindIII (5’) and XhoI or BamHI at (3’) sites using HindIII-HF and XhoI-HF or BamHI-HF (New England Biolabs).
-
bioRxiv - Microbiology 2023Quote: ... The 32P-radioabelled RNase III.RNA complexes were washed and unique barcoded 5’ linkers and 3’ App-PE adapters were ligated to the bounded RNA using 40 U T4 RNA ligase I (NEB) for each ligation step ...
-
bioRxiv - Microbiology 2023Quote: ... was synthetized by introducing a 984 bp fragment from the 3′ end of the GEXP15 ORF into pGDB between the XhoI/AvrII (New England Biolabs). PetDuet-1 was purchased from Novagen.
-
bioRxiv - Biochemistry 2023Quote: ... The oligonucleotides were labeled at the 3’ terminus with [α-32P] dCTP (Hartmann-Analytic) by terminal transferase (New England Biolabs) prior to annealing ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 nM RNAse-free DNA fragments containing gRNA target sequences and 30 nM Cas9 or Cas12a protein (NEB, Ipswich, MA) were mixed in reaction tubes as per manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... IVT RNA products (2×10-3 dilution) were tested for absence of carry-over plasmid template by PCR using Taq 2X master mix (NEB). A negative PCR result would confirm the absence of carryover plasmid in the IVT product.
-
bioRxiv - Microbiology 2022Quote: ... The cDNA was treated with RNase H before second-strand synthesis by Klenow fragment (3′ to 5′ exonuclease) (New England Biolabs), then the double-stranded cDNA was sheared into average of 200 bps fragments using a Covaris focused ultrasonicator E210 ...
-
bioRxiv - Microbiology 2022Quote: ... The 5’-RNA adapter (5’-CCUUGGCACCCGAGAAUUCCA-3’) was ligated to the 5’ end of the RNA using T4 RNA ligase I (NEB). RNA was purified as above by binding to streptavidin beads ...
-
bioRxiv - Molecular Biology 2022Quote: ... were annealed to an oligonucleotide containing the antisense of the 3’ restriction site (5’-GGT TGA TTA TCG ATA AGC TT-3’) and extended using Klenow Polymerase devoid of exonuclease activity (NEB). Resulted fragments were inserted into the pAAV-CAG-hFXN plasmid between the stop codon of the hFXN and poly A signal ...
-
bioRxiv - Synthetic Biology 2022Quote: ... or PCR amplified using primers that anneal to the 5’ or 3’ ends of each chunk with Phusion polymerase (New England Biolabs). Plasmid digested or PCR amplified chunks were excised from agarose gels or column purified ...
-
bioRxiv - Plant Biology 2022Quote: ... The entry module pGG-B-AtU6-26-BRI1-2-C and pGG-A-AtU6-26-BRI1-3-B were generated by annealing oligos for each gRNA and ligating into BbsI-digested (New England Biolabs) Golden Gate entry vectors described in (66) ...
-
bioRxiv - Physiology 2022Quote: RNA-sequencing libraries were prepared by depleting eukaryotic ribosomal RNA with the NEBNext rRNA Depletion Kit prior to library synthesis with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina and addition of multiplex oligos using the Unique Dual Index Primer Pairs Set 3 (NEB). Library quality control was performed using Qubit and Bioanalyzer 2100 ...
-
bioRxiv - Microbiology 2022Quote: ... the pulL gene was PCR-amplified from plasmid pCHAP8258 as template using primers PulL Kpn 5 and PulL Eco 3 with the high-fidelity Q5 DNA polymerase (New England Biolabs). The PCR products were purified on a Qiaquick spin column ...
-
bioRxiv - Cell Biology 2022Quote: ... The 3′ end of the fragmented RNA was dephosphorylated with T4 polynucleotide kinase (PNK, New England Biolabs, Ipswich, MA, USA) followed by heat-inactivation ...
-
bioRxiv - Molecular Biology 2024Quote: The golden gate assembly reaction was assembled in a PCR tube by mixing 100 ng of the vector with a 3 fold molar excess of the purified PCR product (calculated using the NEB bio calculator ...
-
bioRxiv - Bioengineering 2024Quote: ... anchored primer was used to create a complementary strand to the TdT extended products using 15 units of Klenow Fragment (3′→5′ exo-) (NEB) in 1× NEB2 ...
-
bioRxiv - Bioengineering 2024Quote: ... Illumina adapters were ligated on at the 3′ end of the complementary strand using 1× TA Ligase Master Mix (NEB). All products were indexed and sequenced on an Illumina MiSeq instrument ...
-
bioRxiv - Plant Biology 2023Quote: ... without its Stop codon and with a Gly-Gly-Ser-Gly-linker at the 3’-end was first amplified using Q5 High-Fidelity DNA Polymerase (New England Biolabs) and the primers GGB_OEP7_F – AACAGGTCTCAAACAATGGGAAAAACTTCGGGAGC and GGC_OEP7_GGSG_R – AACAGGTCTCTAGCCTCCAGATCCTCCCAAACCCTCTTTGGATGTGG ...
-
bioRxiv - Biochemistry 2024Quote: ... and tRNAGln with 5 nt-long 5’ leader and same 24 nt-long 3’ trailer as tRNATyr (5–tRNAGln–24) – were transcribed in reactions containing 1x T7 RNA polymerase reaction buffer (NEB), 0.001% (w/v ...
-
bioRxiv - Cancer Biology 2024Quote: ... and two BsmBI Type IIS restriction enzyme sites was cloned into the 3’ end of the bovine U6 promoter using Gibson Assembly (NEBuilder HiFi, NEB) (see Supplementary Figure 1a) ...
-
bioRxiv - Molecular Biology 2024Quote: ... the double-stranded (ds) cDNA was PCR amplified with primers directed against 5’ and 3’ RNA cassettes and NEB Q5 HotStart polymerase (NEB). To introduce unique barcodes secondary PCR was performed using TrueSeq primers (NEB ...
-
bioRxiv - Neuroscience 2024Quote: Adult worms from INF418 (nonEx106[myo-2p::GCaMP8f::unc-54 3’UTR]) and INF96 (syIs391[myo-2p::NLS::GAL4SK::VP64::unc-54 3’UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] ...
-
bioRxiv - Cell Biology 2024Quote: ... and 5’-ACG CGT ACT AGT CGA TCG CTT GTA CAG CTC GTC CAT G-3’ (reverse primer) and using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: Each 900 ng of high molecular weight NA12878 DNA was preprocessed by first blocking at the 3’ ends with Klenow (exo-) (NEB) in the presence of 10 µM dideoxynucleotides and 1X NEBuffer 3.1 for 30m at 37°C ...