Labshake search
Citations for New England Biolabs :
2851 - 2900 of 7751 citations for 6 methyl 5 4 phenyl 1 3 thiazol 2 yl 2 trifluoromethyl nicotinic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... Then 3 µL USER Enzyme (NEB, Ipswich, MA, USA) was used with size-selected ...
-
bioRxiv - Biophysics 2021Quote: ... Fragmented 5’-OH sites were phosphorylated by treatment with 5 units of T4 polynucleotide kinase (NEB) for 1 hour at 37 °C ...
-
bioRxiv - Molecular Biology 2019Quote: ... castellii genomic sequence in between the ORFs NCAS0D00680 and NCAS0D00690 was amplified (primers: Ncas_Int618_For 5′-GTTCGCCGGCCTTCCCGCGCTATGAAATTA and Ncas_Int618_Rev 5′-ATCAGGCGCCGAGCATAACCGCTCAAATGC) and inserted between the NaeI and KasI (NEB) restriction sites ...
-
bioRxiv - Molecular Biology 2022Quote: ... the DTB-GTP cap was removed leaving a 5’ monophosphate terminus using RNA 5’pyrophophohydrolase (NEB), RNA was bound to AMPure beads and eluted in low TE (10mM Tris pH8.0 ...
-
bioRxiv - Molecular Biology 2019Quote: ... castellii genomic sequence downstream of the ORF NCAS0C00690 was amplified (primers: Ncas_Int696_For: 5′-GGCCGGTACCAATTCATCTAGCAGGATGTAAAATG; Ncas_Int696_Rev: 5′-GAAAGCCGGCGTAGAGCATGCGAGGTTTGG) and inserted between the KpnI and NaeI (NEB) restriction sites in pRS404 (3) ...
-
bioRxiv - Molecular Biology 2019Quote: ... castellii genomic sequence upstream of the ORF NCAS0E03540 was amplified (primers: Ncas_Int701_For 5′-ATTCGGATCCTGCAGGCTGTTTGCTGTACT; Ncas_Int701_Rev 5′-GGTGGCGGCCGCGGGGTAACTATCCGCGTCTAA) and inserted between the BamHI and NotI (NEB) restriction sites in pRS402 (5) ...
-
bioRxiv - Immunology 2022Quote: ... Vκcons 5’GGCTGCAGSTTCAGTGGCAGTGGRTCWGGRAC3’ and Jκ5SHM 5’AGCGAATTCAACTTAGGAGACAAAAGAGAGAAC3’ using Phusion High-Fidelity DNA Polymerase (New Englands Biolabs) and according to following program ...
-
bioRxiv - Bioengineering 2022Quote: ... and single amino acids were made by KLD site directed mutagenesis (New England Biolabs). Rotavirus antigens were designed based on optimized sequences described previously ...
-
bioRxiv - Molecular Biology 2020Quote: ... The nucleic acids were subsequently radiolabeled with γ32P-ATP using T4 polynucleotide kinase (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... Gel fragments of homozygous clones were extracted using Monarch Nucleic Acid Purification Kits (NEB) and submitted for Sanger Sequencing ...
-
bioRxiv - Immunology 2020Quote: ... and gel fragments of clones were extracted using Monarch Nucleic Acid Purification Kits (NEB) and submitted for Sanger Sequencing ...
-
Human immunodeficiency virus-1 induces and targets host genomic R-loops for viral genome integrationbioRxiv - Molecular Biology 2024Quote: ... Half of the fragmented nucleic acids were digested with RNase H (New England Biolabs) overnight at 37°C to serve as a negative control ...
-
bioRxiv - Microbiology 2023Quote: ... Extracellular nucleic acids were removed with DNase I (New England Biolabs, 20 U/mL) and RNase A (New England Biolabs ...
-
bioRxiv - Biochemistry 2023Quote: ... Amino acid substitution mutants were prepared using the Q5 mutagenesis method (New England Biolabs) with oligonucleotides from IDT ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 µL T4 PNK buffer (NEB), 1 µL SUPER In (Invitrogen) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 5 μL 10X CutSmart buffer (NEB), and 35 μL H2O at 37°C for 16 hours then 80°C for 20 minutes ...
-
bioRxiv - Biophysics 2022Quote: ... 5 units of Phi29 DNAp (NEB) was loaded in the presence of 20 nM RPA and the specified concentration of dNTPs.
-
bioRxiv - Genomics 2022Quote: ... 5 U of RecBCD (NEB, M0345), 10 μg BSA ...
-
bioRxiv - Genomics 2020Quote: ... 5 μl T4 polynucleotide kinase (NEB), 1 μl T4 DNA Polymerase (NEB ...
-
bioRxiv - Immunology 2021Quote: ... 5 μL of GC Enhancer (NEB), 5 μL of 5X buffer,10 mM dNTPs ...
-
bioRxiv - Genomics 2021Quote: ... Subsequent 5’ dephosphorylation by CIP (NEB) followed by decapping with RppH (NEB ...
-
bioRxiv - Genetics 2020Quote: ... 5 µL SbfI-HF (NEB R3642L), 50 µL 10x CutSmart NEB buffer ...
-
bioRxiv - Synthetic Biology 2021Quote: ... coli (NEB 5-alpha competent cells), isolated using the Monarch Plasmid preparation kit (NEB ...
-
bioRxiv - Genetics 2020Quote: ... and 5 μl CviAII (NEB R0640S). The digestion was performed at room temperature for 2 hours ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 units of Taq polymerase (NEB), and 5 pmoles each of the following primers ...
-
bioRxiv - Genomics 2022Quote: ... 5 U of RecBCD (NEB, M0345), 10 μg BSA ...
-
bioRxiv - Microbiology 2022Quote: ... 5’-phosphorylated with T4 PNK (NEB) and annealed oligonucleotides were used for UP-homology (oBA1761/oBA1762 or oBA1765/oBA1766) ...
-
bioRxiv - Neuroscience 2022Quote: ... Subsequent 5’ dephosphorylation by quickCIP (NEB) followed by decapping with RppH (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... NEB 5-alpha (New England Biolabs), or XL-10 Gold (Agilent ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 ul 10X PNK buffer (NEB), 1 ul RNaseOUT ...
-
Removal of Spo11 from meiotic DNA breaks in vitro but not in vivo by Tyrosyl DNA Phosphodiesterase 2bioRxiv - Molecular Biology 2019Quote: ... 5 units of lambda exonuclease (NEB) for 1 hour at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... 5× Phusion HF buffer (NEB, USA), a dNTP nucleotide mix containing 200 μM of each nucleotide (Promega) ...
-
A genome-scale CRISPR interference guide library enables comprehensive phenotypic profiling in yeastbioRxiv - Genomics 2020Quote: ... 5 U lambda exonuclease (NEB M0262S), and 20 U E ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 U of T4 PNK (NEB) were included in the initial NsiI digestion reaction and incubated at 37 °C for one hour.
-
bioRxiv - Molecular Biology 2021Quote: ... 5 μl ExoI buffer (NEB, B0293S), 5 μl CutSmart buffer (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 μl CutSmart buffer (NEB, B7204S), and 30 μl nuclease-free water and incubated for 1 hour at 37 °C and 10 minutes at 80 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNase H (5 U, NEB, M0297S) was added followed by incubation at 37 °C for 20 min and 65 °C for 20 min ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μg/ml DNase I (NEB), 1x PhosStop phosphatase inhibitor cocktail (Roche) ...
-
bioRxiv - Immunology 2020Quote: ... 5 μL of GC Enhancer (NEB), 5 μL of 5X buffer,10 mM dNTPs ...
-
mRNA vaccines and hybrid immunity use different B cell germlines to neutralize Omicron BA.4 and BA.5bioRxiv - Immunology 2022Quote: ... 5 μL of GC Enhancer (NEB), 5 μL of 5X buffer,10 mM dNTPs ...
-
bioRxiv - Microbiology 2022Quote: ... or exonuclease III (NEB, 5 units) were performed on 2 – 3 μg of DNA extracted from virus particles for 1 h at 37 °C ...
-
bioRxiv - Microbiology 2022Quote: ... coli NEB® 5-alpha (NEB) according to the instructions of the manufacturer ...
-
bioRxiv - Biophysics 2024Quote: ... 5 units of antarctic phosphatase (NEB), and 1 mM manganese chloride ...
-
bioRxiv - Immunology 2024Quote: ... 5 μL of GC Enhancer (NEB), 5 μL of 5X buffer,10 mM dNTPs ...
-
bioRxiv - Genomics 2024Quote: ... 5 μl of CutSmart 10x (NEB), 2 μl of BSA (NEB) ...
-
bioRxiv - Genomics 2023Quote: ... or 5 U MboI (NEB R0147S) in 15 μl rCS buffer for 1 h at 37°C and analysed in a 1.2% agarose gel containing ethidium bromide ...
-
bioRxiv - Genetics 2023Quote: ... 5 units of Antarctic Phosphatase (NEB) and 10 mU/µL of phosphodiesterase I (PDEI ...
-
bioRxiv - Microbiology 2023Quote: ... and Adenosine 5’-Triphosphate (ATP) (NEB). After RNA recovery using an RNA MinElute Cleanup Kit (QIAGEN) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 U BsaI-HFv2 (NEB, R3733L), 250 U T4-ligase and nuclease-free water for a total of 5 µl reaction mix ...
-
bioRxiv - Microbiology 2023Quote: ... 5 μL of GC Enhancer (NEB), 5 μL of 5X buffer,10 mM dNTPs ...