Labshake search
Citations for New England Biolabs :
2851 - 2900 of 3027 citations for 6 Hydroxy 3 nitro 2 picoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... The PCR product was denatured and annealed in an 18 μl reaction (15 μl PCR product, 2 μl NEB Buffer2 (10X), 1 μl nuclease-free H2O ...
-
bioRxiv - Microbiology 2021Quote: Cloning of the plf gene clusters and plfG and papG genes encoding the different classes of adhesins were obtained by PCR amplification using specific primers (Table 2) and Q5 High Fidelity-DNA polymerase (New England Biolabs [NEB]). The A-Tailing Kit (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 µl Forward Stagger Mix (10 µM) and 2 µl Reverse Index Primer (10 µM) specific to each vector backbone and Nuclease-free water (NEB,USA) up to 50 µl ...
-
bioRxiv - Microbiology 2020Quote: ... 1 mL of the IEC fraction was concentrated for 4 h in vacuum to which 20 μL of the dried sample and 2 μL of 10xGlyco Buffer (New England Biolabs™) were added into 2 mL Eppendorf tube and incubated in the thermomixer at 99 °C for 10 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... 10 µL of a 1000 U of DNase I stock was added to 500 µL of DNase I buffer on cells for 10 minutes or 2 µL of a 5000 U of RNase H stock (NEB M0297S) was added to 500 µL of RNase H buffer on cells for 5 minutes at 45 °C ...
-
bioRxiv - Microbiology 2021Quote: ... DNA fragments located upstream and downstream to the epitope insertion sites were amplified by PCR using the Q5® High-Fidelity 2 × Master Mix (NEB) with relevant primers (Table 1 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The amplicons were analyzed by 1.5% agarose gel electrophoresis with ethidium bromide staining and using a DNA ladder marker (2 log DNA ladder from New England Biolabs, USA). Amplicon bands were observed under UV light ...
-
bioRxiv - Immunology 2021Quote: ... Add 50 μl of 10X NEB Buffer 2 and 375 U (15 μl of 25 U/ μl) of MboI restriction enzyme (NEB, R0147), and digest chromatin for 2 hours at 37°C with rotation ...
-
bioRxiv - Immunology 2020Quote: ... NEBNext® Multiplex Oligos for Illumina® (Index Primers Set 1 and 2) and NEBNext Poly(A) mRNA Magnetic Isolation Module (New England Biolabs). Library quantification was performed by real-time PCR using the KAPA Library Quantification Kit - Illumina Platforms - Complete kit (Universal ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μl of 10 mM MnCl2 and 1-2 μl (400-800 units) of λ PP (New England Biolabs, Ipswich, MA). Untreated lysates received 1-2 μl of water in place of λ PP ...
-
bioRxiv - Genomics 2020Quote: ... and used for PCR amplification of the target region using the Q5® Hot Start High-Fidelity 2× Master Mix (NEB), followed by evaluation of the PCR products by gel electrophoresis and purification with the Qiaquick PCR purification kit (28104 ...
-
bioRxiv - Genomics 2021Quote: ... PCR amplification of the samples was performed using Nextera primers 1 and 2 and NEBNext High fidelity master mix (NEB, M0541S) for 12 cycles as determined by KAPA Real-Time Library Amplification Kit (Peqlab ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μl 10 pM/μl TrAEL-seq adaptor 1 (49) and 1 μl T4 RNA ligase 2 truncated KQ (NEB M0373L). Plugs were then rinsed with 1 ml tris buffer ...
-
bioRxiv - Microbiology 2020Quote: ... HDR editing-specific PCR was performed on 2 μL of samples using the OneTaq polymerase (New England Biolabs, Whitby, ON, Canada) and primers T5a_mut_fwd (5’-AAATAATCTACGGGGCCGGCGGCACAG ...
-
bioRxiv - Biophysics 2022Quote: ... the reaction was diluted to 90 µl and was supplemented with 10 µl DNAse I buffer and 2 µl DNAse I enzyme (NEB #M0303S) and incubated for 15 minutes at 37□ C to degrade the DNA template ...
-
bioRxiv - Developmental Biology 2022Quote: ... equal amount of DNA (∼2 ng) was used as an input for NEB Ultra II DNA library prep kits (NEB #E7645). Number of cycles for amplification of adapter ligated libraries were estimated by the qPCR before final amplification to avoid any bias arising due to PCR amplification and indexing (NEB #E7350) ...
-
bioRxiv - Biochemistry 2022Quote: ... the sample was diluted to 50 μL with ammonium bicarbonate buffer and incubated at 37 °C with 2 μL of PNGase F (New England Biolabs P0705S) diluted 1:100 in ammonium bicarbonate for an additional 7 hours ...
-
bioRxiv - Cell Biology 2022Quote: ... Dephosphorylation of CRL4B took place in a 100 μl reaction mixture containing 86 μl of CRL4B protein (at 0.8 mg/ml) with 2 μl λ-phosphatase (λ-PP) in the presence of 0.1 mM MnCl2 and 1x PMP reaction buffer (NEB). Untagged-CRL4 complexes (4A ...
-
bioRxiv - Cell Biology 2022Quote: ... the sequence encoding amino acids 1-490 was amplified with NdeI and EcoRI overhangs and inserted into a modified backbone based on pSNAP-tag(T7)2 (NEB #N9181S) before a SNAPf-EGFP-6His tag (Budaitis et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... An IFT144 construct lacking the N-terminal β-propeller domain (residues 2–349 inclusive; IFT144ΔNFLAG) was made using the Q5® Site-Directed Mutagenesis Kit (NEB).
-
bioRxiv - Genetics 2022Quote: ... 500 ng of purified PCR products (D2500, Gel Extraction Kit, OMEGA, USA) were denatured and reannealed in NEB buffer 2 (M0302S, NEB, USA): 95 ℃ ...
-
bioRxiv - Microbiology 2022Quote: RNA-free PXO99A genomic DNAs (0.2 μg) were used to construct the DNA libraries using a NEBNext Ultra DNA Library Prep Kit for Illumina (NEB, USA) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... The transformation vector pICU2:Cas9-dsRED containing the Cas9 gene from Streptococcus pyogenes expressed under the promoter of the Arabidopsis Incurvata 2 gene (ICU2, At5g67100) was combined with the gRNA combinations by Gibson assembly (NEB, USA). For RPB1 ...
-
bioRxiv - Plant Biology 2022Quote: ... including the stop codon and (2) the CDS and native promoter region 1024 bp upstream using Phusion High Fidelity DNA polymerase (NEB, USA) and TA-ligated into the entry vector pCR8/GW/TOPO (Thermo ...
-
bioRxiv - Molecular Biology 2023Quote: ... Beads were next resuspended in 1X Thermo Pol Buffer and treated with 2 µL RNA 5’ Pyrophosphohydrolase (New England Biolabs M0356) at 37°C for 1 h to promote decapping of 5’ RNA ends ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The cDNAs were subcloned into vectors through conventional ligation with Ligation high Ver.2 (Toyobo, Japan) or NEBuilder HiFi DNA Assembly (New England Biolabs, MA) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2.5 uL each 10 uM forward and reverse primers (cTF223, cTF218 - see Supp. Table 2) and 25 uL NEBNext Q5U Master Mix (NEB, M0597) and ran the following thermocycling protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... The biotin handle and cosmid-I95 DNA were both digested for 2 h at 37 °C with SpeI-HF (New England Biolabs, R3133L) and subsequently heat-inactivated for 20 min at 80 °C ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Libraries were created using 1000ng of total RNA with the NEBNext Ultra 2 Directional RNA Library Kit following the Poly(A) mRNA Magnetic Isolation Module (NEB #E7490) and sequenced on an Illumina Hi-Seq 2000 ...
-
bioRxiv - Cell Biology 2024Quote: The plasmids used in this study were obtained from the sources as noted in Table 2 or made by either restriction digest and ligation or PCR and NEBuilder HiFi DNA assembly (New England Biolabs E5520S). Insert sequences were ordered as custom GeneBlocks from IDT or isolated from existing plasmids ...
-
bioRxiv - Genomics 2024Quote: ... Amplicons were then barcoded for NGS by combining 2 µL of amplicon from the previous PCR with 1X Q5 High-Fidelity Master Mix (New England Biolabs M0492) and 500 nM forward and reverse indexing primers (Integrated DNA Technologies) ...
-
bioRxiv - Microbiology 2024Quote: ... were digested with NotI and the wc-1 and wc-2 fragments were cloned into the respective plasmids with NEB HiFi DNA assembly mastermix (NEB, US). This resulted in the prey plasmid wc-1-pMB29 and bait plasmid wc-2-pMB28 ...
-
bioRxiv - Biochemistry 2024Quote: ... 125 μg of λ-phage DNA was mixed with two oligos (2 μM oligo Lab07 (/5Phos/AGG TCG CCG CCC/3BioTEG) and 2 μM oligo Lab06 (/5Phos/GGG CGG CGA CCT/3BioTEG) in 1× T4 DNA ligase reaction buffer (NEB B0202S) and heated to 70°C for 15 min followed by gradual cooling to 15°C for 2 hours ...
-
bioRxiv - Cancer Biology 2024Quote: ... followed by PCR amplification of the BC-sgRNA1-sgRNA2 region from 32 μg of bulk lung genomic DNA using Q5 Ultra II High-Fidelity 2× Master Mix (New England Biolabs, M0494X). Unique dual-indexed primers were used to amplify each sample followed by purification using Agencourt AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Biophysics 2023Quote: Tau was phosphorylated in vitro according to previous protocols with some modifications.12,88 50 µL of 100 µM tau was incubated with 2 µg cAMP-dependent Protein Kinase (PKA, New England BioLabs P6000S) and/or 0.4 µg GSK3β (Sigma-Aldrich G4296 ...
-
bioRxiv - Neuroscience 2023Quote: ... Final nuclear lysates were resuspended using 100 µl of resuspension solution (1x PBS + 2% BSA + 0.2U/µl RNase inhibitor - New England Biolabs, Cat#: M0314S). Hoechst staining was performed to assess the quality of isolated nuclei based on their shape ...
-
bioRxiv - Pathology 2023Quote: ... cDNA then was used as a template for barcoding PCR following ONT’s protocol (SQK-LSK110 with EXP-PBC096) and LongAmp Taq 2× Master Mix (NEB, Ipswich, MA). The barcoded amplicons were bead purified at a 0.8× beads:solution ratio before being pooled by equal volume with libraries from unrelated samples and a library generated from HeLa RNA (ThermoFisher)
-
bioRxiv - Molecular Biology 2022Quote: ... pHAGE lentiviral plasmids encoding the six other HCoV N-EGFP were generated by replacing SARS-CoV-2 N with the respective HCoV N sequences by PCR (New England Biolabs M0492S) and NEBuilder HiFi DNA Assembly (New England Biolabs E2621S) ...
-
bioRxiv - Neuroscience 2023Quote: ... the coverslips were washed in 2×SSC for 30 minutes for a total of four washes and then stored at 4°C in 2×SSC supplemented with 1:100 Murine RNase inhibitor (New England Biolabs, M0314S) for no longer than 2 weeks prior to imaging.
-
bioRxiv - Genetics 2023Quote: Library oligos for the prime editing screen were synthesized by Twist Bioscience and amplified using the NEBNext High-Fidelity 2× PCR Master Mix (NEB M0541L) with the forward primer GTGTTTTGAGACTATAAATATCCCTTGGAGAAAAGCCTTGTTT and the reverse primer CTAGTTGGTTTAACGCGTAACTAGATAGAACCGCGGTGTTAGG ...
-
bioRxiv - Biophysics 2023Quote: ... These plasmids were digested with NotI-HF and XhoI for 2 h at 37°C (R3189, R0146, New England Biolabs, UK) and heat-inactivated for 20 min at 80°C.
-
bioRxiv - Genomics 2023Quote: ... thirty 20 μl ePCRs were performed using 400 ng of DNA for each reaction and NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541S) with the following primers ...
-
bioRxiv - Genomics 2023Quote: ... cells were then pelleted at 500xg for 2 min at 4°C and then resuspended in 200 μl of 1 × T4 DNA ligase buffer (NEB, B0202S) containing 0.2% SDS ...
-
bioRxiv - Biochemistry 2023Quote: ... The mutant and wild-type target RNA were subsequently amplified using either the NEB Luna SARS-CoV-2 RT-qPCR Multiplex Assay Kit (NEB E3019), Luna Probe One-Step RT-qPCR 4X Mix with UDG (NEB M3019 ...
-
bioRxiv - Cell Biology 2022Quote: ... The mutant fragments were amplified by high-fidelity DNA polymerase 2 × Phanta Max Master Mix followed by DpnI (New England BioLabs; R0176S) digestion in 37°C for 1 hour to eliminate the templates ...
-
bioRxiv - Genetics 2023Quote: ... PCR products were analyzed on 2% Agarose gels with 0.5 ng/L Ethidium bromide using a 1kb Plus DNA Ladder (New England BioLabs Cat # N3200S) for size reference ...
-
bioRxiv - Genetics 2022Quote: ... and 2 μg of DNA was digested with 50 units of NlaIII and 5 μL CutSmart® Buffer (NEB, cat #R0125L), in a total volume of 50 μL ...
-
Striated muscle-specific base editing enables correction of mutations causing dilated cardiomyopathybioRxiv - Genetics 2022Quote: ... RT-PCR or qPCR was performed with 1 μl of 1:2 diluted cDNA using the Q5®Hot Start High-Fidelity 2X Master Mix (NEB) or the SYBR™ Green PCR Master Mix (ThermoFisher) ...
-
bioRxiv - Developmental Biology 2023Quote: ... was combined with either MEP-1 or Mi-2 PCR-amplified coding sequences in a Gibson assembly reaction using NEBuilder® HiFi DNA Assembly kit (NEB) following manufacturers protocols ...
-
bioRxiv - Molecular Biology 2023Quote: ... All mRNAs were transcribed at 30°C for 2 hrs using the HiScribe T7 High Yield RNA Synthesis Kit (NEB # E2040S) and were co-transcriptionally capped (8:1 cap analog to GTP for ∼90% capping efficiency ...