Labshake search
Citations for New England Biolabs :
2801 - 2850 of 10000+ citations for Rat Heat Shock Protein Beta 2 HSPB2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... the particles were captured by magnetic stand and proteins captured by the particles were separated by SDS-PAGE and examined by immunoblotting using MBP antibody (NEB, #E8032S). For the immunoblot ...
-
bioRxiv - Biochemistry 2024Quote: ... the crude extract containing 100 μg (in 100 μL volume) of proteins was treated with 400 units of λ-PPase (#P0753; New England Biolabs) for 60 min at 30 °C ...
-
bioRxiv - Cell Biology 2024Quote: All purified SNAP-tagged proteins were labeled with 10-fold molar excess of SNAP-Surface dyes (New England Biolabs, Ipswich, MA) in labeling buffer (1× PBS ...
-
bioRxiv - Microbiology 2023Quote: ... Each protein was then isolated and affinity-purified using an amylose resin according to the manufactureŕs protocol (New England Biolabs, Ipswich, US) and the concentration was determined using the Bradford technique ...
-
CXCL17 binds efficaciously to glycosaminoglycans with the potential to modulate chemokine signallingbioRxiv - Immunology 2023Quote: ... WT SUMO3-CXCL17 and variants were expressed as soluble proteins in SHuffle® T7 Competent E.coli (New England Biolabs, Hitchin, UK). In both protocols ...
-
bioRxiv - Cell Biology 2023Quote: ... The protein was then purified by affinity-purification using an amylose beads according to the manufacturer’s protocol (New England Biolabs, Ipswich, USA) and the concentration determined by Bradford assay ...
-
bioRxiv - Cell Biology 2023Quote: Beads with bound Flag-RAD50 or GFP-BRCA1 were washed with 5M NaCl to eliminate contamination with protein kinases and incubated with 100 or 500 U of CK2 holoenzyme complex (α2/β; NEB) in 30 μl of kinase buffer (20 mM Tris-HCl (pH 8.0) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Unligated 3’ linker was removed by incubating the samples with the 5’-deadenylase KmHnt3 (see Recombinant protein expression and purification) and RecJ exonuclease (New England Biolabs, M0264S) for 45 min at 37 °C ...
-
bioRxiv - Biophysics 2023Quote: ... Trypsin digestion was initiated by adding 1:10 (trypsin to protein, m/m) mass spectrometry grade trypsin (New England Biolabs #P8101S) in 50 mM ammonium bicarbonate ...
-
bioRxiv - Cell Biology 2024Quote: The cell lysates or purified PINK1 bound to FLAG beads were incubated at 30°C for 1h with 200 units of ʎ protein phosphatase (LPP) in a total reaction of 100µL following the instructions of the manufacturer (New England Biolabs #P0753).
-
bioRxiv - Cell Biology 2024Quote: We fused SNAP-3xHA coding sequences downstream H3.1 and H3.3 CDS 46 and inserted this fusion protein into the pBS31 vector 70 using NEBuilder® HiFi DNA Assembly Master Mix (NEB). These expression vectors (pB31-H3.1- and pB31-H3.3-SNAP-3xHA ...
-
bioRxiv - Evolutionary Biology 2020Quote: Sequencing libraries were prepared using either the “NEBNext Ultra II DNA Library Prep Kit for Illumina®” (E7645) or the “NEBNext Ultra II FS DNA Library Prep Kit for Illumina®” (E7805) (New England BioLabs, Ipswich, USA). Sequencing was conducted on an Illumina MiSeq System (Illumina Inc. ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The described method follows the NEBNext® Ultra™ II DNA Library Prep Kit (v4.0) with Sample Purification Beads Kit (New England Biolabs, Ipswich, Massachusetts, USA). But other kits can be used too ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... or the NEBNext Ultra DNA Library Prep Kit for Illumina (formerly NEBNext DNA Library Prep Kit for Illumina; New England Biolabs Inc., Ipswich, Massachusetts, U.S.) and the NEBNext Multiplex Oligos for Illumina were used for library preparations ...
-
bioRxiv - Developmental Biology 2019Quote: ... An amount of 500 ng total RNA was used for RNA-seq library preparation with NEB NEBNext rRNA Depletion Kit and ENBNext Ultra Directional RNA Library Prep Kit (New England Biolabs Japan Inc., Tokyo, Japan); 2 × 36 base paired-end sequencing was performed with NextSeq500 (Illumina K.K. ...
-
bioRxiv - Neuroscience 2024Quote: ... Samples with a RIN greater than 7 were processed for library preparation with NEBnext rRNA depletion kit and ULTRAII FS RNA-seq Library Preparation Kit for Illumina (New England Biolabs, Ipswich, MA, United States). This procedure involved steps for mRNA enrichment ...
-
bioRxiv - Microbiology 2020Quote: ... purified and ligated for 2 h at room temperature using the Instant Sticky-end Ligase Master Mix (NEB, Australia) following the manufacturer’s protocol ...
-
bioRxiv - Genetics 2021Quote: Cells from each fin sample obtained as described before were washed in 2 ml PBS supplemented with 0.1% bovine serum albumin (BSA) (NEB). Each sample was divided into two replicate tubes ...
-
bioRxiv - Microbiology 2020Quote: ... These gBlocks fragments and a NdeI-HindIII-digested pET21b backbone were assembled using a 2× Gibson master mix (NEB). Two and a half μL of each fragment at equimolar concentration was added to 5 μL 2× Gibson master mix (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... 5 mM MgCl2, 10% Glycerol, 0.05% NP-40, 2 mM DTT, 10 mM Ribonucleoside-Vanadyl complex [New England Biolabs, MA USA] ...
-
bioRxiv - Molecular Biology 2021Quote: ... 500 ng total RNA in a volume of 9 μl was ligated to 1 μl custom adapter mix (18S:28S ratio 1:2) using 1.5 μl T4 DNA ligase (New England Biolabs) in NEB next Quick ligation buffer (3 μl ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA (400ng) was then ligated the 3’adaptor (5’-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3’) using T4 RNA ligase 2(NEB) for 4 h at 37°C ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and then a final extension at 72°C for 2 minutes using Q5 High-Fidelity Polymerase (New England BioLabs). We conducted a nested PCR to sequence exon 2 (204bp ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 µl 10 x dNTPs with dUTP instead of dTTP (2 mM each) and 1 µl T4 polymerase (NEB) were added and the mixture was incubated at 37°C in a thermal cycler for 20 min ...
-
bioRxiv - Biophysics 2022Quote: ... both were mixed (∼5μM acceptor strand and ∼2 μM phosphorylated donor strand in a final volume of 19μl) in T4 RNA ligation buffer (New England BioLabs) supplemented with 1mM ATP (New England BioLabs) ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA (400ng) was then ligated the 3′adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′) using T4 RNA ligase 2 (NEB) for 4 h at 37°C ...
-
bioRxiv - Genomics 2020Quote: ... and permeabilized for 5 min on ice in PBS containing 0.5%Triton X-100 and 2 mM Ribonucleoside Vanadyl complex (New England Biolabs). Coverslips were preserved in 70% EtOH at -20°C ...
-
bioRxiv - Genomics 2019Quote: ... and resuspended in 198 µL A-tailing solution (1× NEB buffer 2, 500 mM dATP, 1% Triton X-100). DNA ends were A-tailed by adding 1.5 µL Klenow (exo- ...
-
bioRxiv - Developmental Biology 2020Quote: ... oligonucleotides for the HAS-1 or HAS-2 sgRNA guide sequences were phosphorylated using T4 PNK (NEB, Ipswich, MA) for 30 min at 37°C ...
-
bioRxiv - Immunology 2019Quote: ... Single cells were flow-sorted into 96-well plates containing 2 µL of nuclease-free water with 0.2% Triton X-100 and 4 U murine RNase inhibitor (NEB), centrifuged ...
-
bioRxiv - Molecular Biology 2019Quote: ... SI) were incubated for 2 hours at RT in T4 ligase buffer with 400 U of T4 ligase (NEB) in a total volume of 100 µl ...
-
bioRxiv - Genetics 2021Quote: ... 53.5 μl of cut 3C library was mixed with 6.5 μl NEBNext FFPE Repair Buffer and 2 μl NEBNext FFPE Repair Mix (New England Biolabs), followed by incubation at 20°C for 15 minutes and addition of 3 volumes of AMPure XP beads for purification.
-
bioRxiv - Plant Biology 2020Quote: ... A 3 μl aliquot of the purified DNA fragments was blunted in a 20 μl reaction containing 2 μl buffer 2.1 (New England Biolabs), 1 μl 2 mM dNTPs ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and 5 µl of CutSmart buffer and 2 µl of EcoRI-HF® (New England Biolabs, catalog no. R3101) were added before incubation for 6 h at 37°C ...
-
bioRxiv - Bioengineering 2021Quote: ... and assembled with oncocin and true negative oligo inserts (Supplementary Table 2) with NEBuilder® HiFi DNA Assembly (NEB), and cloned in 5α E ...
-
bioRxiv - Bioengineering 2021Quote: The LAMP reagent mix in a total volume of 25 μL contained 12.5 μL of WarmStart or Colorimetric WarmStart 2 × Master Mix (New England BioLabs) or Bsm polymerase (Thermo Scientific) ...
-
bioRxiv - Genomics 2021Quote: ... non integrated plasmids were cut by 2 h digestion at 37 °C with I-CeuI restriction enzyme (NEB, R0699S) in a total volume of 70 ul followed by 20 minutes heat inactivation at 65 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... The Pre-hybridization Buffer was replaced with 250 μl of Hybridization Buffer (2x SSC, 10% deionized formamide, 0.1% Tween-20, 2 mM vanadyl ribonucleoside complex (New England Biolabs), 100 μg/mL salmon sperm DNA (Invitrogen) ...
-
bioRxiv - Physiology 2021Quote: ... with 2 mL freshly prepared TST buffer (0.03% Tween 20 [Bio-Rad], 0.01% Molecular Grade BSA [New England Biolabs] ...
-
Insights into the secondary structural ensembles of the full SARS-CoV-2 RNA genome in infected cellsbioRxiv - Biochemistry 2021Quote: ... 2 μl of the circularized product was then used for PCR amplification using Phusion High-Fidelity DNA Polymerase (NEB) for a maximum of 16 cycles ...
-
bioRxiv - Bioengineering 2021Quote: 2 μl of genomic DNA was used to amplify strain barcodes by PCR (Q5 NEB master mix, 22 cycles) using primers containing sequence-optimized spacers to maximize nucleotide diversity in Illumina sequencing ...
-
bioRxiv - Systems Biology 2020Quote: ... We discarded the supernatant and resuspended the pellet in 2 mL of 1x NEB buffer 3.1 (New England Biolabs).
-
bioRxiv - Microbiology 2021Quote: ... 40 μL purified supernatant were combined with 2,500 units recombinant glycerol-free PNGase F and Glycobuffer 2 (New England Biolabs) following the manufacturer’s protocol for non-denaturing digestion and incubated at 37°C for 5 hours ...
-
bioRxiv - Biophysics 2020Quote: ... and loaded denatured (70 °C, 10 minutes) samples alongside an RNA ladder (2-4 μL, ssRNA ladder, N0362S, NEB). The resulting gels were stained with ethidium bromide for 30 minutes (0.5 μg/mL ddH20 ...
-
bioRxiv - Cancer Biology 2022Quote: ... The pellet was dissolved and digested in 50 ml buffer A with 2 mM CaCl2 and 4,000 units of micrococcal nuclease (M0247S, NEB) at RT for 20 min ...
-
bioRxiv - Bioengineering 2022Quote: ... 2 ul of cDNA without dilution was used for each PCR reaction by Phusion® HighFidelity DNA Polymerase (NEB) for 35 cycles ...
-
bioRxiv - Biochemistry 2022Quote: ... 4 μg of supercoiled plasmid DNA was incubated at 37 °C for 3 hours with purified SpRY protein at a final concentration of 1 μM and IVT gRNA (prepared without DNase treatment) at a final concentration of 2 μM in Buffer 3.1 (NEB). Reactions were stopped by the addition of 1 μL of Proteinase K (NEB ...
-
bioRxiv - Genomics 2019Quote: ... We added 1 μL 12.5% Triton-X to each well to quench the SDS and 12.5 μL NEBNext High-Fidelity 2× PCR Master Mix (NEB). Samples were PCR-amplified for 12 cycles (72 °C 5 min ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The solution was then equilibrated to 42°C for 10 min before adding 2 μL of β-agarase (NEB). Finally ...
-
bioRxiv - Biochemistry 2021Quote: ... The reactions were stopped by addition of 2 μl of no SDS-purple gel loading dye (New England BioLabs) or 50% glycerol ...