Labshake search
Citations for New England Biolabs :
2801 - 2850 of 6266 citations for 7 Diethylamino 3 nitro 2H 1 benzopyran 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... the pMIR319C containing pMW#2 reporter constructs were linearized with XhoI (R0146, New England Biolabs, USA) and integrated into the mutant HIS3 locus of the YM4271 host strain (Gift from Ram Yadav ...
-
bioRxiv - Microbiology 2023Quote: ... mmpL10 and papA3 and the flanking intergenic sequence was amplified using Q5 HiFi 2× MasterMix (NEB) from genomic DNA isolated from M ...
-
bioRxiv - Neuroscience 2022Quote: The Gr64f promoter was PCR amplified using Q5 High-Fidelity 2× Master Mix (New England Biolabs) from the Gr64f-GAL4 (107 ...
-
bioRxiv - Genetics 2022Quote: ... 25 µl LongAmp Hot Start Taq 2’ Master Mix (New England BioLabs, Frankfurt am Main, Germany). The PCR program was 94°C for 1 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... TrAEL-seq adaptor 2 was added using a modified NEBNext Ultra II DNA kit (NEB E7645S): 3.5 μl NEBNext Ultra II End Prep buffer ...
-
bioRxiv - Neuroscience 2023Quote: ... cells were placed on ice for 2 minutes before adding 250 µL SOC medium (Biolabs #B9020S). The transformed cells in medium were incubated in a shaker for 1 hour at 37°C and 225 RPM ...
-
bioRxiv - Systems Biology 2023Quote: ... 400 µL of RNAlater and 2 µL of 20 mg/mL BSA (New England Biolabs # B9000S) were added to the samples and incubated on ice for 5 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: crRNA (Supplementary Table 2) was synthesized using a HiScribe T7 High Yield RNA Synthesis Kit (NEB). The DNA sequences includes the T7 promoter at the 5’ end and the sequence from crRNA with the target sequence at the 3’ end ...
-
bioRxiv - Cancer Biology 2023Quote: ... and preadenylated linkers were ligated to the RNA fragments using T4 RNA Ligase 2 K277Q (NEB). After 5’ deadenlyase and RecJ exonuclase treatment ...
-
bioRxiv - Bioengineering 2023Quote: ... 40 U/mL Rnasin) and then resuspended in ligation buffer plus 2 μM SplintR Ligase (NEB). Cells were incubated for 1h at 37 ºC with gentle agitation.
-
bioRxiv - Molecular Biology 2023Quote: ... the enzymatic activity of the commerically availablale recombinant vaccinia virus methyltransferase mRNA 2’O-methyltransferase (NEB), abbreviated hereagter as VMTR1 ...
-
bioRxiv - Biochemistry 2023Quote: ... Riboswitch samples were prepared by splinted ligation using T4 RNA ligase 2 (New England Biolabs M0239S). 5 nanomoles each of the 5’ and 3’ segments of the riboswitch and the DNA splint were combined and heated to 90 °C for 2 minutes and then allowed to cool to RT over 10 minutes ...
-
bioRxiv - Genetics 2024Quote: ... and libraries were generated by PCR with NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541). Prior to sequencing ...
-
bioRxiv - Immunology 2024Quote: ... The region of interest was then amplified using Q5 2× mastermix (New England Biolabs, cat. M0492S), 500 ng of template DNA ...
-
bioRxiv - Genomics 2024Quote: A ligation reaction was then assembled by combining 2 μl 10x T4 DNA ligase buffer (NEB), 1 μl annealed 20 μM Index_A_XX stock ...
-
bioRxiv - Biochemistry 2024Quote: ... incubated for 2 hours at 30 ° C and stopped by addition of 0.2 U apyrase (NEB), incubated at 30 ° C for 20 mins ...
-
bioRxiv - Cancer Biology 2024Quote: ... the pLenti CRISPR V2 was digested for 2 h at 50°C with Bsmb1 (NEB, R0580S) and the resulting digested fragment was purified using the NucleoSpin Gel and PCR Clean-up kit (Macherey-Nagel ...
-
bioRxiv - Systems Biology 2024Quote: ... 66U/μl truncated T4 ligase 2 and 13U/μl murine RNAse inhibitor (all from NEB, USA)) were added at 25°C for 1h ...
-
bioRxiv - Cell Biology 2020Quote: ... 1:50,000 (NEB, and anti-GST HRP conjugates ...
-
bioRxiv - Genomics 2022Quote: ... and then ‘A’ base was added to 3’ blunt ends using the A-Tailing reaction (NEBNext® UltraTM II End Repair/dA-Tailing Module, NEB, Cat. E7546). The purified A-tailed DNA was ligated with adaptors from the Ligation Sequencing Kit (SQK-LSK109 ...
-
bioRxiv - Genomics 2019Quote: ... 3 μg RNA was used to generate sequencing library by using NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, USA). PCR was carried out using Phusion High-Fidelity DNA polymerase ...
-
bioRxiv - Neuroscience 2019Quote: ... The cassette was amplified by PCR then ligated to the donor template using Gibson Assembly Master Mix (NEB, primers in Supplementary Table 3). The reaction was incubated at 50 °C for 15 minutes ...
-
bioRxiv - Plant Biology 2021Quote: ... a non-adenylated 3’ adapter was ordered for chemical synthesis from IDT™ and adenylated with the 5’ DNA Adenylation Kit (New England Biolabs® Inc.) (see Supplemental Table 4 for primers and adapters used) ...
-
bioRxiv - Cell Biology 2022Quote: Living ovaries were incubated at room temperature in SNAP solution containing 3 μM SNAP- Cell TMR-Star or SNAP-Cell 647SiR (New England BioLabs, S9105S and S9102S), 10% FCS and 0,2 mg/ml Insulin in Schneider’s medium ...
-
bioRxiv - Microbiology 2021Quote: ... The digested DNA (4 ml in total) was split into 4 aliquots and diluted in 8 ml ligation buffer (1X ligation buffer NEB 3 (without ATP), 1 mM ATP ...
-
bioRxiv - Zoology 2021Quote: ... a total of nine RNA libraries were prepared with 3 μg RNA using NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, USA) following manufacturer’s recommendations ...
-
bioRxiv - Plant Biology 2021Quote: ... Detection of editing in the EBE region of CsLOB1 promoter was performed by amplifying the target region (primers in Supplementary Table 3) with high fidelity DNA polymerase Q5 (New England Biolabs, Ipswich, MA, USA), followed by cloning of PCR products and sequencing.
-
bioRxiv - Molecular Biology 2024Quote: ... hereafter called Flag-SERCA2-C) were constructed from 3×Flag-SERCA2 using a Q5 Site-Directed Mutagenesis Kit (New England BioLabs, Ipswich, MA, USA). mCherry-Sec61B (Addgene ...
-
bioRxiv - Microbiology 2024Quote: ... 3 ug RNA was treated with Promega RQ1 DNase (M6101) then cleaned up with the Monarch® RNA Cleanup Kit (NEB Biolabs, T2050S) and eluted in 30 µl dH2O.
-
bioRxiv - Synthetic Biology 2023Quote: ... The inserted barcoding sequences were annealed using randomized overlapping single stranded oligonucleotides by adding 3 µl of each oligonucleotide (100 µM) to 500 µl 1x 2.1 NEB-buffer (New England Biolabs, Ipswich, MA, USA, #B6002S) followed by boiling at 100 °C for 3 minutes to finally let them associate during the cooling to room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... digoxigenin-11-ddUTP was added to the 3’ end of the digested fragments using terminal transferase enzyme (New England Biolabs, Ipswich, MA, USA).
-
bioRxiv - Microbiology 2023Quote: ... The upstream and downstream PCR products were designed to have an overlapping region of sequence to promote 3-part Gibson assembly (NEB Gibson assembly kit) and primers 5b and 4 had extensions to anneal to vector pMP62 ...
-
bioRxiv - Molecular Biology 2023Quote: All PolD mutants (Supplementary table 3) were generated using pLB047 and a Q5 Site-Directed mutagenesis kit (E0554 New England Biolabs Inc., Ipswich MA) as described by the manufacturer ...
-
bioRxiv - Physiology 2024Quote: ... and PCR was performed with Flag F (caaggacgacgatgacaaagtc) + 3’OUTR (CAGAGCCAACAACGTGAGGT) primers using Q5® High-Fidelity DNA Polymerase (New England Biolabs, MA, USA) according to the manufacturer’s protocol ...
-
Chromosome-level assembly of Cucumis sativus cv. ‘Tokiwa’ as a reference genome of Japanese cucumberbioRxiv - Genomics 2024Quote: ... we put 3 μg of the size-selected DNA for end-repair using NEBNext FFPE DNA Repair Mix (NEW INGLAND BioLabs inc., Massachusetts, USA) and NEBNext Ultra II End Repair/dA-Tailing Module ...
-
bioRxiv - Microbiology 2024Quote: ... RNA was synthesized from a DNA template (Supplementary Table 3) using the HiScribe T7 High Yield RNA Synthesis Kit (NEB, Ipswich, MA, USA) and treated with DNase I (NEB ...
-
bioRxiv - Cell Biology 2024Quote: ... GFP mRNA was produced in-house using the Hiscribe® T7 Quick high yield RNA synthesis kit and 3’-O-me-m7G cap analog (New England Biolabs, MA, USA) following the manufacture’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... followed 1 hr recovery in 1 mL pre-warmed SOC (NEB) at 37°C 250 rpm ...
-
bioRxiv - Biochemistry 2019Quote: ... 1/20-1/50 (w/w) GluC protease (New England BioLabs) was added and incubated 24-48 h at 4°C ...
-
bioRxiv - Biophysics 2021Quote: ... The chamber was incubated with 1 mg ml−1 streptavidin (NEB) and washed with MBCT ...
-
bioRxiv - Microbiology 2020Quote: ... 1 U of DNase 1 (New England Biolabs, Ipswich, MA US) per ∼100 µl lysate (37°C ...
-
bioRxiv - Biochemistry 2024Quote: ... 100 μL of 1 unit mL-1 SfoI restriction enzyme (NEB) was injected to generate blunt-end DNA molecules.
-
bioRxiv - Molecular Biology 2024Quote: ... Samples were mixed 1:1 with 2x RNA dye (NEB B0363S), loaded on TBE gels ...
-
bioRxiv - Biophysics 2023Quote: ... 1 μl Cutsmart buffer and 1 U Sau96I (New England Biolabs) were added into the system ...
-
bioRxiv - Systems Biology 2023Quote: ... 1 μl of SUPERase_In and 1 μl of T4 PNK (NEB)) and incubated at 37 °C for 1 hr ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 unit/µl T4 RNA ligase 1 (New England Biolabs, M0204S) and incubated at 23°C for 150 min ...
-
bioRxiv - Microbiology 2024Quote: ... 1 μl RNAse at 10mg/ml (NEB, cat no. T3018-1), and 1/10th volume of DNAse I reaction buffer (NEB cat ...
-
bioRxiv - Biochemistry 2020Quote: ... Diatom exconjugants were selected on 1/2L1 1% agar medium supplemented with 20 μg mL−1 phleomycin (Gold Biolabs) at a diel cycle of 14:10 at ~50 μE ms−1 light intensity.
-
bioRxiv - Molecular Biology 2024Quote: ... 1 µg non-methylated NEAT1_1 IVT product was radio-labelled with radioactive labelling mix (1 µL 10x PNK buffer, NEB, 1 µL NEAT1_1 IVT product, 1 µL T4 PNK, NEB, 1 µL γ-32P-ATP ...
-
bioRxiv - Microbiology 2020Quote: ... PCR protocols entailed an initial phase of 95° C for 3 min using Hot Start Taq polymerase (New England BioLabs Inc., Ipswich, MA, USA), followed by 35 cycles at 50°C and 52°C annealing temperatures for 16S and ITS amplicons respectively ...