Labshake search
Citations for New England Biolabs :
2751 - 2800 of 3130 citations for Locostatin CAS 90719 30 5 100% since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... CHART-enriched DNA was eluted twice in 200 μL of elution buffer supplemented with 5 U/μL RNase H (New England BioLabs) at room temperature for 20 min ...
-
bioRxiv - Microbiology 2024Quote: ... was mixed with an 80-mer spike-in RNA oligonucleotide internal standard (DNA and RNA oligonucleotide sequences in Table S5).5 The mixture was dephosphorylated shrimp alkaline phosphatase (rSAP, NEB) in NEB T4 RNA ligase buffer at 37 °C for 30 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... In vitro RNA transcription was performed in 50 µl reactions: 5 µl RNAPol Reaction Buffer (New England BioLabs, Ipswich, MA), 2 µl T7 RNA Polymerase (New England BioLabs ...
-
bioRxiv - Microbiology 2024Quote: ... Diluted supernatants were used as the template DNA (5 μL) for qPCR using a 2×Luna universal qPCR master mix (New England BioLabs), with 0.5 μM of primers ...
-
bioRxiv - Biochemistry 2024Quote: ... 1-5 mL of cell pellet was harvested for plasmid extraction with the Monarch Plasmid DNA Miniprep Kit (New England Biolabs) (T1010) ...
-
bioRxiv - Biochemistry 2024Quote: ... When relevant cmpRNA (500 pmol) was 5’-end phosphate-32 “hot” labeled using fresh gamma phosphate-32 labeled ATP (50 nmol) and PNK (NEB) following the producer’s recommendations ...
-
bioRxiv - Biochemistry 2024Quote: ... cDNA was PCR amplified using the primers directed against 5′ and 3′ RNA cassettes and NEB Q5 HotStart polymerase (NEB). To introduce unique barcodes ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3’ and 5’ ends were modified accordingly and the respective adapters were ligated with a T4 RNA ligase I (New England Biolabs). The final products were size-selected one last time and rRNA depletion was performed using custom-made biotinylated oligos(38 ...
-
bioRxiv - Neuroscience 2024Quote: ... slides were rinsed three times with deionized water for 5 minutes and incubated in 1x Terminal Transferase (TdT) buffer containing 1X buffer 4 (NEB) and 2.5 μM CoCL2 for 10 minutes at room temperature in a humid chamber ...
-
bioRxiv - Neuroscience 2024Quote: ... after removing the Gel Coverslip, slides were incubated in 5 ml warmed Clearing Solution (ref. 20300003, Vizgen) with Proteinase K (ref. P8107S, NEB) in a sealed petri dish for 24 hours at 37°C.
-
bioRxiv - Physiology 2024Quote: ... the following reagents were added to each tube containing 1 cell in ∼5 μL: 2 μL M-MuLV Reverse Transcriptase Reaction Buffer (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 89 nt product was phosphorylated with T4 PNK and a final 20 nt RNA oligo with sequence GGCUUCGCAGUCCUUAGAAG (Chemgenes) was ligated to the 5’ end of the 89 mer using T4 RNA Ligase 1 (NEB). Finally ...
-
bioRxiv - Neuroscience 2024Quote: ... and nuclease-free water in a 5:10:1:34 ratio) supplemented with 0.8 U/µl Proteinase K (NEB P8107S) for 48-72 hours in a humidified 37 °C incubator.
-
bioRxiv - Microbiology 2024Quote: ... 5 µL of BL21 competent cells (or, in the case of the disulfide stabilized cspg binders, T7 shuffle express) (NEB) were dispensed onto the 1 µL reactions ...
-
bioRxiv - Plant Biology 2024Quote: ... the full length coding sequences of cowpea VuLHY1 (Vigun10g1533300) and VuLHY2 (Vigun09g004100) were amplified from a 5’ RACE cDNA library using the Q5 High-Fidelity DNA polymerase (NEB) and specific primers (Table S1) ...
-
bioRxiv - Physiology 2024Quote: ... Stranded mRNA-Seq library construction was carried out using 5 μL of purified mRNA (15-75ng) and NEBNext Ultra Directional RNA Library Prep Kit (New England Biolabs). First and second strand cDNA synthesis ...
-
bioRxiv - Biochemistry 2024Quote: ... Purified RNA redissolved in 5 µl of 10% (v/v) DMSO was combined with 1x T4 RNA Ligase Buffer (New England Biolabs), 0.5 U/µl SuperaseIN (Invitrogen) ...
-
bioRxiv - Systems Biology 2024Quote: ... Both the DNA libraries and the pBAD33 plasmid backbone were then gel-purified and used for a ligation reaction in 5:1 molar ratio using the T4 DNA ligase (NEB). After PCR-purification of the ligation ...
-
bioRxiv - Biochemistry 2024Quote: 5 uL of GFP conditioned medium or 1 ug of each purified antibodies was treated with PNGase-F (NEB, P0704L) or Endo-H (NEB ...
-
bioRxiv - Genomics 2024Quote: ... The purified PCR was digested overnight at 37°C in a 120 μL reaction (5 μL BsaI-HF (NEB R3733L), 5 μL BlpI ...
-
bioRxiv - Cancer Biology 2024Quote: ... Site-directed mutagenesis of SOX10 5’UTR was performed using Q5® Site-Directed Mutagenesis Kit (New England Biolabs, #E0554) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2024Quote: ... Bead-bound microglial nuclei were resuspended in 25 µL Antibody Incubation Buffer (995 µL Wash Buffer with 5 µL 200x BSA [B9000S, New England Biolabs]).
-
bioRxiv - Genomics 2024Quote: ... 1: 120) diluted in the hybridization buffer (10% deionized formamide, 2X SSC, 100mg tRNA, 5% dextran sulfate, 2mM VRC (NEB), 0,2mg/mL BSA) ...
-
bioRxiv - Biochemistry 2024Quote: ... Run-off transcription was then performed using 5 ng of PCR amplified template (HiScribe T7 High Yield RNA Synthesis kit; NEB), followed by DNase treatment (TURBO DNase ...
-
bioRxiv - Biophysics 2024Quote: ... Positively supercoiled DNA was prepared by incubating with 9°N Reverse Gyrase (5 units/μg DNA, M0200, provided by New England Biolabs) in 35 mM Tris-HCl (pH 7.5 at 25 °C) ...
-
bioRxiv - Cell Biology 2024Quote: The full-length open reading frame of SYP-5 was synthesized as a gBlock (IDT) and cloned into pMAL (New England Biolabs) to express Maltose-binding protein (MBP)-tagged SYP-5 with a 6xHis tag at the N-terminus ...
-
bioRxiv - Cell Biology 2024Quote: ... the cDNA library was cleaned using the Monarch PCR & DNA Cleanup Kit (5 μg) (T1030L, New England Biolabs, MA, USA) using the 7:1 ratio of binding buffer:sample as per the manufacturer’s instructions and was eluted in 27.5 μL nuclease-free water ...
-
bioRxiv - Cell Biology 2024Quote: ... and 5 μL of the product was transformed by heat shock into 10-beta competent cells (New England Biolabs, C3019I). Cells were then plated on agarose plates (supplemented with ampicillin 100 μg/mL ...
-
bioRxiv - Biochemistry 2024Quote: ... either at the 5’ or 3’ of the trimerization domain and then inserted into a pET29b+ vector using PaqCI (NEB). Briefly ...
-
bioRxiv - Cell Biology 2024Quote: ... and 5 μL of the product was transformed by heat shock into 10-beta competent cells (New England Biolabs, C3019I). Cells were then plated on agarose plates (supplemented with ampicillin 100 μg/mL ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... of which 5 μl was processed with the NEBNext Ultra Directional RNA Library Prep Kit for Illumina (New England Biolabs) with published modifications to the manufacturer’s protocol (Batty et al ...
-
bioRxiv - Pathology 2022Quote: ... Total RNA was subjected to two rounds of poly(A) selection using oligo-d(T)25 magnetic beads (New England Biolabs, CA, USA). Illumina compatible RNAseq library was prepared using NEB next ultra RNAseq library preparation kit ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... the complete genome sequences were amplified for CYVCV CA isolates using the Q5 high-fidelity enzyme (New England Biolabs Inc., MA, USA) and virus-specific PCR primers (5′ primer-GAAAAGCAAACATAACCAACACACACCC ...
-
bioRxiv - Synthetic Biology 2021Quote: ... NEB 10x Standard Taq Reaction buffer (100 mM Tris-HCl, 500 mM KCl, 15 mM MgCl2, pH 8.3) (New England Biolabs, Ipswich, MA), 2× PCR reaction mix (2× Standard Taq Reaction buffer ...
-
bioRxiv - Genetics 2021Quote: ... We then amplified 10 uL of cDNA in 100 uL PCR reactions using NEBNext Ultra II Q5 Master Mix (NEB, M0544S) and Lib_Seq_eGFP_F2 and Lib_Hand primers for either 8 or 3 cycles (MPRA 1 and 2 respectively) ...
-
bioRxiv - Microbiology 2020Quote: ... Approximately 100 ng of gDNA was used as template for PCR using Q5 Hot Start DNA Polymerase (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Molecular Biology 2021Quote: ... chromatin and RNA were digested in 100 µL MNase digestion solution (1x micrococcal nuclease (MNase) buffer and 40 units/µl MNase (NEB, #M0247)) for 5 min at 37 °C while shaking at 1,400 rpm in a thermomixer ...
-
bioRxiv - Molecular Biology 2020Quote: ... The plug was equilibrated with 100 μl CutSmart buffer containing 5 mM DTT and 1 mM dATP for 1 hour at room temperature before incubation for 2 h at 37°C in another 100 μl of the same buffer containing 1 μl Klenow exo-(NEB M0212S) and 1 μl T4 PNK (NEB M0201S) ...
-
bioRxiv - Molecular Biology 2021Quote: ... then incubated for 2 h at 37°C in 100 μl 1x TdT buffer containing 4 μl 10 mM ATP and 1 μl Terminal Transferase (NEB M0315L). Plugs were rinsed with 1 ml tris buffer (10 mM Tris HCl pH 8.0) ...
-
bioRxiv - Molecular Biology 2021Quote: ... DNA was precipitated and resuspended in ligation master mix (1X NEB Ligation buffer, 0.8% Triton X-100, 0.5X BSA, 1600U of T4 DNA ligase (NEB, Catalog number: M0202). The reaction was incubated at 21 °C for 4 hours ...
-
bioRxiv - Genomics 2021Quote: ... 5.25 mg of genomic DNA (gDNA) was used as template across 525 x 100 µL PCR reactions using Q5 2X Master Mix (NEB, M0492L). For the distal sub-library screens ...
-
bioRxiv - Synthetic Biology 2021Quote: Illumina sequencing libraries were generated from 100-200 ng BAC DNA using NEBNext Ultra II FS DNA Library Prep Kit (New England Biolabs E7805S) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... 2 μg genomic DNA from mESCs (both, with DSB induction and control without the induction) were digested using 1 μl 100 U/μL XbaI (NEB, #R0145T) and 4 μl 5 U/μL I-SceI (NEB ...
-
bioRxiv - Cell Biology 2021Quote: The recovery probe was prepared as follows: A standard 100 µl PCR reaction was prepared containing 10 ng of bacteriophage λ DNA (NEB), 5 units of Taq polymerase (NEB) ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were again pelleted and resuspended in 900 μL fixation buffer and gently sonicated before 100 μL of 200 mM RNase inhibitor vanadyl ribonucleoside complex was added (New England BioLabs, S1402S). Cells were then digested by adding 3.5-5 μL zymolyase stock (5 mg/mL 100T ...
-
bioRxiv - Plant Biology 2021Quote: ... 100 ng of gDNA were used to set up a PCR using Phusion® High-Fidelity DNA Polymerase (New England BioLabs). The PCR product was separated in a 1% agarose gel by electrophoresis ...
-
bioRxiv - Genomics 2021Quote: Restriction digestion was carried out by adding 25 μL of 10 ×NEBuffer 2 and 100 U of the MluCI restriction enzyme (NEB, R0538) and incubating for ≥2 hours at 37°C in a Thermomixer at 900 rpm ...
-
bioRxiv - Zoology 2021Quote: ... amplicons were analyzed by 1.5% agarose gel electrophoresis with ethidium bromide staining and using a DNA ladder marker (2 log, 100 bp, or 1 kb DNA ladder from New England Biolabs, USA). Expected PCR product sizes of the first step and nested PCR step were 514 and 148 bp ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 µg of GST-beads were incubated for 15 min on ice in GRB buffer in a 25 μl reaction volume with 1 µg of 100 bp DNA ladder (New England Biolabs # N3231S) or mononucleosome (Active motif # 81070) ...
-
Sequential dynein effectors regulate axonal autophagosome motility in a maturation-dependent pathwaybioRxiv - Cell Biology 2020Quote: ... and either BICD2N-Halo (50 pmol) or CBD-HAP1CC1 (100 pmol) was incubated with resin (Magne® HaloTag, Promega, G7281; Chitin, New England BioLabs, S6651 ...