Labshake search
Citations for New England Biolabs :
2751 - 2800 of 6746 citations for 7 Oxabicyclo 2.2.1 hept 2 ene 5 6 6 trifluoro 1 methyl 1R 4S 5S rel 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... The RNA adaptor provided by the kit was phosphorylated on its 5’ end using T4 Polynucleotide Kinase (NEB). RNA (1 μg ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA templates were then degraded by incubating reactions with 5 units of RNase H (M0297, New England Biolabs) and 1 μl RNase cocktail enzyme mix (AM2296 ...
-
bioRxiv - Biochemistry 2023Quote: Pre-crRNA was 5’-radiolabeled with [γ−32P] ATP (Perkin-Elmer) using T4 polynucleotide kinase (New England Biolabs). For some measurements ...
-
bioRxiv - Molecular Biology 2023Quote: ... For ligation, samples were washed in CutSmart buffer, preincubated (5 min, RT) in 1x T4 ligase buffer (NEB), and incubated (18 h ...
-
bioRxiv - Cancer Biology 2023Quote: ... followed by addition of a phosphate group to the 5’ end using T4 polynucleotide kinase (T4 PNK, NEB). Next ...
-
bioRxiv - Cell Biology 2023Quote: ... A stock solution of these oligos (1μl of a 10μM) was 5’-end-labeled using T4PNK (NEB®) and 5μl of ATP ...
-
bioRxiv - Genomics 2023Quote: ... DNA was then pre-amplified 5 cycles with NEBNext Ultra II Q5 master mix (New England Biolabs, M0544) with a cycling protocol of 72°C for 5 min ...
-
bioRxiv - Genomics 2023Quote: ... 2.5 µl of 100 mM dATP solution and 2.5 µl of Klenow Fragment (3′->5′ exo-) (NEB, #M0212L) were added to the mixture ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 0.5 μL BsaI-HF® v2 NEBridge® Golden Gate Assembly mix (E1601, NEB, 5 μL final volume), and 0.5 μL T4 DNA ligase buffer was aliquoted across a PCR plate ...
-
bioRxiv - Biochemistry 2023Quote: ... dynein-bound beads were mixed with 5 µM SNAP-Cell-TMR or SNAP-AlexaFluor-647 (New England Biolabs) for 10 min at RT ...
-
bioRxiv - Cell Biology 2023Quote: ... For an R-loop negative control the preparation was treated with 5 U RNaseH (M0297S, NEB Japan, Japan) in 1× RNaseH Reaction Buffer (NEB Japan ...
-
bioRxiv - Molecular Biology 2023Quote: ... Oligonucleotides corresponding to the ‘right’ half were 5′-phosphorylated using T4 polynucleotide kinase (New England Biolabs, Ipswitch, MA). Equimolar amounts of ‘right’ strand ...
-
bioRxiv - Molecular Biology 2023Quote: ... three 25 μl PCR reactions were pooled and purified using Monarch PCR & DNA Cleanup Kit (5 μg; NEB), according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli strain MET961 was constructed by replacing the glgB gene of strain NEB 5-alpha (New England Biolabs) with the glgB::Kan-pWV01repA region from E ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 μL of the polyC-tailed products were used with 1X Taq Mg-free Buffer (New England Biolabs), 500 nM of each primer (Table 2) ...
-
bioRxiv - Genetics 2024Quote: ... Around 300 ng of sRNA from each sample was first treated with RNA 5′ pyrophosphohydrolase (New England Biolabs) at 37 °C for 30 min ...
-
bioRxiv - Genetics 2024Quote: ... An additional 20-minute digestion was then performed with 5 µL RNase A (NEB #T3018, 20 mg/ml). The rest of the protocol remained unchanged ...
-
bioRxiv - Cell Biology 2024Quote: ... dynein-bound beads were mixed with 5 μM SNAP-Cell-TMR or SNAP-AlexaFluor-647 (New England Biolabs) for 10 minutes at room temperature.
-
bioRxiv - Molecular Biology 2024Quote: ... using ETAA1 DBR R1 RT-PCR primer 5′-AAGTTCTTCTTCTTGACTTTGTGTT-3′ and treated with RNaseH (New England Biolabs, M0297S). 1μl of the cDNA was used for PCR amplification reactions using using GoTaq® G2 DNA Polymerase (Promega ...
-
bioRxiv - Biochemistry 2024Quote: ... and then 5’ phosphates of the nucleotide sample were removed with 0.5 units of quick-CIP (NEB, #M0525) at 37 ºC for 2 hr with agitation at 800 rpm for 1 min every 10 min.
-
bioRxiv - Microbiology 2024Quote: ... followed by a 5-min extension cycle using Q5® High-Fidelity 2X Master Mix (New England Biolabs). PCR products were then purified using QIAquick® Gel Extraction Kit (Qiagen ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5% glycerol) and one time with molecular grade water followed by incubation with proteinase K (New England Biolabs) at 55 °C for 30 minutes ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5% glycerol) and one time with molecular grade water followed by incubation with proteinase K (New England Biolabs) at 55 °C for 30 minutes with constant shaking ...
-
bioRxiv - Molecular Biology 2024Quote: ... The labeling of oligonucleotides at the 5’-end was carried out by T4 polynucleotide kinase (New England Biolabs) and [γ-32P] ATP (Hartmann Analytic) ...
-
bioRxiv - Biophysics 2021Quote: ... the SNAP-tag fragment was digested from the pSNAP-tag (T7)-2 vector (New England Biolabs), inserted into pET-28b plasmid resulting in a construct referred as pET-SNAP ...
-
bioRxiv - Cell Biology 2019Quote: ... the HeLa cells were kept in HeLa culture media treated overnight with 0.2 U/mL of □2-3,6,8,9 Neuraminidase (New England Biolabs) to cleave sialic acid from the cell surface glycans.
-
bioRxiv - Cell Biology 2020Quote: ... and 2) the insert and pcDNA5-FRT-TO were digested with 40U of EcoRV-HF (NEB) and 40U of XhoI (NEB).
-
bioRxiv - Cell Biology 2020Quote: ... peak fractions pooled and reacted with 2-molar excess SNAP-substrate Alexa-488 dye (S9129, NEB) overnight at 4°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Products were then ligated to 3’ adaptor (/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/) by T4 RNA ligase 2(NEB) and 5’ adaptor (rGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCr-GrArCrGrArUrCrNrNrNrCrGrArNrNrNrUrArCrNrNrN ...
-
bioRxiv - Molecular Biology 2021Quote: ... The nuclei were harvested and resuspended in 0.5ml cold 1.2x NEB Buffer 2 (New England Biolabs), incubated with 0.3% SDS for 1 hr at 37°C ...
-
bioRxiv - Genomics 2022Quote: ... 10 μl 2X Quick T4 ligase buffer and 2 μl Quick T4 DNA ligase (NEB, M2200L) were added to the reaction and incubate at 37 °C for overnight ...
-
bioRxiv - Genomics 2020Quote: ... 66U/μl truncated T4 ligase 2 and 13U/μl murine RNAse inhibitor (all from NEB, USA)) were added to the aRNA/adapter solution ...
-
bioRxiv - Genomics 2019Quote: ... was ligated to the 3’-ends of the RNA using T4 RNA Ligase 2 (NEB #M0242L) in presence of PEG 8000 (2.5% w/v) ...
-
bioRxiv - Molecular Biology 2019Quote: ... in the presence of Quick Ligase enzyme and 2× Quick Ligase Reaction buffer (New England BioLabs). Before transfer to the yeast ...
-
bioRxiv - Developmental Biology 2019Quote: Pceh-23_L::acy-2 fragment(anti-sense) was generated with a Gibson assembly cloning kit (NEB) by assembly of the following two DNA fragments ...
-
bioRxiv - Cancer Biology 2019Quote: ... was ligated to the RNA fragments on bead using T4 RNA ligase 2 truncated KQ (NEB M0373 ...
-
bioRxiv - Developmental Biology 2021Quote: ... 10 µl of PCR product was then mixed with 1.5 µl 10X NEBuffer 2 (B7002S, NEB) and 1.5 µl of Nuclease-free water ...
-
bioRxiv - Plant Biology 2021Quote: ... using BamHI and XhoI restriction sites and 2× Gibson Assembly master mix (NEB, Ipswich, MA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Vcan exon 2 and exon 3 were amplified using Phusion Taq (NEB, catalog no. F530L) (see SI) ...
-
bioRxiv - Microbiology 2022Quote: ... a sequencing library was constructed with the NEBNext ARTIC SARS-CoV-2 FS kit (NEB E7658S). For each viral variant ...
-
CRISPR-Cas9-mediated knockout of CYP79D1 and CYP79D2 in cassava attenuates toxic cyanogen productionbioRxiv - Plant Biology 2021Quote: ... 2 µL of cDNA mix was added to 50 µL Phusion High-Fidelity DNA Polymerase (NEB) reaction mix ...
-
bioRxiv - Immunology 2021Quote: ... and SARS-CoV-2 RBD were conjugated to SNAP-Capture Pull-Down resin (New England BioLabs). For each conjugation ...
-
bioRxiv - Immunology 2021Quote: ... 2 µL of random primer mix 60 µM (cat. n° S1330S, NEB, New England Biolabs, USA) and 4.8 µL of nuclease-free water ...
-
bioRxiv - Immunology 2021Quote: ... 2 µL of random primer mix 60 µM (cat. n° S1330S, NEB, New England Biolabs, USA) and 4.8 µL of nuclease-free water ...
-
bioRxiv - Cancer Biology 2020Quote: ... The pulse step was performed with 2 µM SNAP-cell TMR Star (New England Biolabs, S9105S) for 15 min followed by two washes with medium ...
-
bioRxiv - Cell Biology 2022Quote: ... after which 2 µL of Recombinant PNGaseF (Glycerol-free) (New England Biolabs, Ipswich, MA; catalog # P0709L) was added to each sample ...
-
bioRxiv - Genetics 2019Quote: ... Approximately 2 micrograms DNA per sample was then digested with XhoI restriction enzyme (New England BioLabs) and processed as described previously [105] ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2-10 ng of starting input genomic DNA was digested with 30 units of MspI (NEB). Fragments were ligated to pre-annealed adapters containing 5’-methyl-cytosine instead of cytosine according to Illumina’s specified guidelines ...
-
bioRxiv - Molecular Biology 2019Quote: ... a master mix was prepared containing 2 µl 10x T4 polynucleotide kinase buffer without ATP (NEB) and 1 µl murine RNase inhibitor per sample and 3 µl were added to each sample together with 2 µl truncated T4 polynucleotide kinase (#M0201 ...
-
bioRxiv - Cell Biology 2020Quote: ... PCR was performed with Q5 Hot Start High-Fidelity 2 × Master Mix (#M0494L, New England Biolabs) with the amount of input genomic DNA (gDNA ...