Labshake search
Citations for New England Biolabs :
2701 - 2750 of 3576 citations for Vanin 1 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: Mutants in the CG-1 domain were created using the Q5 site-directed mutagenesis kit (New England Biolabs, USA) as per manufacturer instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... with 20 nM DNA or 50 nM RNA with 1 unit RNase Inhibitor (New England Biolabs Inc., Massachusetts, USA), 100 nM methyltransferase ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR amplification was done in a 25µl reaction with 1 unit of NEB Taq DNA polymerase (NEB Catalog# M0273S), 1x Standard Taq Buffer ...
-
bioRxiv - Molecular Biology 2023Quote: For DNA-RNA hybrid IP (DRIP) non-crosslinked lysates were incubated (1 h, 37°C) with 10U RNaseH (NEB) prior to immunoselection ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1.0-3.0 μg of DNA was used for a ligation reaction in a volume of 1 mL using 1.0 μL of 2000 U/μL T4 DNA Ligase (NEB) for 3C experiments ...
-
bioRxiv - Immunology 2023Quote: ... were single-cell sorted into 5 µl 1% (v/v) Nonidet P40 Substitute, Tris-HCl (20 mM, pH 8.0) containing 5 U murine RNase inhibitor (NEB) using a FACSAriaIII instrument (BD) ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 μg of immunopurified GST-tagged WRN fragment was phosphorylated in vitro by Casein Kinase II (New England Biolabs) in the presence of 1X NEBuffer (50mM Tris-HCl ...
-
bioRxiv - Genomics 2023Quote: ... were mixed in 5 μL of 1x T4 DNA Ligase buffer (50 mM Tris-HCl pH 7.5, 10 mM MgCl2, 1 mM ATP, 10 mM Dithiothreitol; New England Biolabs) at a final concentration of 80 μM each and annealed by heating at 65 °C for 15 min ...
-
bioRxiv - Bioengineering 2023Quote: ... mRNA was isolated from ~1 μg of total RNA using NEBNext Poly(A) mRNA Magnetic Isolation Module (NEB #E7490). RNA integrity was assessed using the RNA 6000 Pico Kit for Bioanalyzer (Agilent Technologies 5067-1513) ...
-
bioRxiv - Immunology 2022Quote: ... Then 1 μg of vaccine mRNA was ligated to 20 pmols RA3_7N adaptor: 5rApp/CTGACNNNNNNNTGGAATTCTCGGGTGCCAAGG/3ddC with 10U of T4 KQ227 RNA ligase 1 (#M0204S NEB) in the presence of 20U RNase OUT (#10777019 ...
-
bioRxiv - Cell Biology 2022Quote: ... Tracheal chitin was stained with 505 star conjugated chitin-binding probe (NEB, Frankfurt/M, Germany, used at 1:300). Nuclei were stained with 4’,6-Diamidino-2-Phenylindole ...
-
bioRxiv - Biochemistry 2022Quote: ... and 10 μM GDP and incubated for 1 h at room temperature prior to adding 0.25 units of Apyrase (NEB) and incubation for a further 1 h at room temperature ...
-
bioRxiv - Bioengineering 2023Quote: ... reactions were carried out in a total of 25 μL containing 1 X Isothermal Amplification Buffer (New England Biolabs), 5 mM MgSO4 ...
-
bioRxiv - Immunology 2023Quote: 1 μg of total RNA was subjected to rRNA depletion using the NEBNext rRNA Depletion Kit (New England Biolabs), according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... 0.5 µL of T4 DNA Ligase and 1 µL of 10 mM ATP (all reagents from New England Biolabs, Ipswich ...
-
bioRxiv - Microbiology 2023Quote: ... 20 μL of the reaction product was treated with 1 μL of CIP or nuclease P1 (New England BioLabs) at 37 °C for 1 h and inactivated at 80 °C for 10 min prior to centrifugation and analysis by HPLC.
-
Microhomology-Mediated Circular DNA Formation from Oligonucleosomal Fragments During SpermatogenesisbioRxiv - Genomics 2023Quote: ... Column-bound DNA was eluted in TE buffer (10 mM Tris-Cl, pH 8.0; 1 mM EDTA, pH 8.0) and treated with AsiSI (NEB, R0630S) and PacI (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... To obtain dephosphorylated TOP2B used for in vitro kinase assay and mass spectrometry the YFP column incubated twice for 15 min at room temperature in wash buffer supplemented with 0.1mM MnCl2 and 5 units mL-1 calf intestinal phosphatase (NEB), 400 units mL-1 lambda protein phosphatase (NEB) ...
-
bioRxiv - Biochemistry 2023Quote: ... in a total reaction volume of 100 µL consisting of 50 units of T4 RNA ligase 1 (NEB #M0204S), 1mM ATP ...
-
bioRxiv - Cancer Biology 2023Quote: ... a Poly(A) tailing reaction was performed for 1 hour according to the HiScribe T7 ARCA manual (NEB, E2060S). Subsequently ...
-
bioRxiv - Biochemistry 2023Quote: IVT and co-transcriptional capping reactions were performed in 30 μL reactions containing 1x T7 RNA polymerase buffer (40 mM Tris-HCl, 20 mM MgCl2, 1 mM DTT, 2 mM spermidine, pH 7.9; New England Biolabs), 5 mM each NTPs ...
-
bioRxiv - Molecular Biology 2023Quote: ... Barcoded 3’ adapters (see Extended Data Table 1) were ligated using K227Q truncated T4 RNA ligase 2 (NEB, M0351L) at a concentration of 0.5 µM adapter and in the presence of 25% PEG8000 containing a homemade 10 x ligation buffer (0.5 M Tris pH 7.8 ...
-
bioRxiv - Physiology 2023Quote: ... including DNase 1 treatment (Monarch Total RNA Miniprep kit, #T2010, New England Biolabs, USA and QIAGEN RNeasyMini kit, #74104). Purity and quantity of RNA were assessed by determining the optical density (OD ...
-
bioRxiv - Developmental Biology 2023Quote: ... After centrifugation the EtOH-precipitated fragments were resuspended in water and ligated to 0.25 µM randomized 5’ RNA adapter using T4 RNA ligase 1 (NEB) in the same buffer conditions as described above ...
-
bioRxiv - Biophysics 2023Quote: ... cells were incubated in dye solution (1 μM SNAP-tag ligand BG-AF647 (catalog no. S9136S, New England Biolabs), 1 mM dithiothreitol (catalog no ...
-
bioRxiv - Molecular Biology 2023Quote: NCBP1-NCBP2 at 1.2 μM was incubated with mALYREF2 (residues 1-155) at 3.6 μM in the presence of the 5’ cap analog m7GpppG (NEB) at 500 μM at 4 °C for 0.5 hr ...
-
bioRxiv - Molecular Biology 2023Quote: ... a ratio of 7:1 (oligo:library) was used overnight at 16 °C with T4 DNA ligase (New England Biolabs). The products were purified and eluted in 6 μL water (Zymo Clean and Concentrate) ...
-
bioRxiv - Neuroscience 2023Quote: ... mRNA Magnetic Isolation Module and NEBNext Multiplex Oligos for Illumina (Index Primers Set 1/2/3/4) following the manufacturer’s instructions (New England Biolabs). Quantification and quality checked of libraries was done using an Bioanalyzer 2100 instrument and DNA 7500 kit (Agilent Technologies) ...
-
bioRxiv - Neuroscience 2023Quote: ... Ligation of 5’ adaptor to already 3’ ligated RNA product was performed with T4 RNA ligase 1 (NEB, #EL0021) at 37°C for 1 h ...
-
bioRxiv - Microbiology 2023Quote: ... by mixing 2 ul 1:10.000 diluted library with 8 ul Quant mastermix with added primers (New England Biolabs). Due to low initial concentration of adapter ligated product we made triplicates of the library ...
-
bioRxiv - Genomics 2023Quote: ... Following this, 2μL Exonuclease 1 (20U/μL, Enzymatics X8010L) and 1μL Shrimp Alkaline Phosphatase (rSAP) (1U/μL, NEB M0371L) was added to each reaction followed by vortexing and incubation in a thermocycler at 37°C for 30min followed by 4°C forever.
-
bioRxiv - Molecular Biology 2023Quote: ... aurantiaca DW4/3–1 genomic DNA and cut by restriction enzymes NdeI and HindIII (New England Biolabs, Beverly, USA), and ligated into the corresponding sites of the expression vector pET28c(+ ...
-
bioRxiv - Molecular Biology 2023Quote: ... in buffer 3 (100 mM NaCl, 50 mM Tris-HCl, pH 7.9, 10 mM MgCl2, and 1 mM DTT, New England Biolabs) or in 50 mM NaCl ...
-
bioRxiv - Genetics 2023Quote: ... 8.5 μl of phosphorylated product was combined with 1 μl of 10x T4 ligase buffer and 0.5 μl of T4 DNA ligase (NEB), incubated at 16℃ overnight ...
-
bioRxiv - Biochemistry 2023Quote: ... The coding sequence of mouse PADI4 (residues 1-666) was amplified and cloned into pET28a vector using NdelI (NEB) and XhoI (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... the culture was diluted to 0.1 OD before adding 1 μM silicon-rhodamine benzylguanine derivative SNAP-SiR647 (SNAP-Cell 647-SiR, New England Biolabs). Culture tubes were wrapped in aluminum foil and incubated on a rotator for 15 hours ...
-
bioRxiv - Microbiology 2023Quote: A 10 µL reaction containing 200 ng of pTrc200HA plasmid DNA and 1× CutSmart Buffer (New England BioLabs, USA) with partially purified V2c or its variants normalized by the major V2c protein band was incubated at 37°C for 1 hour ...
-
bioRxiv - Bioengineering 2023Quote: ... cells were incubated in dye solution (1 μM SNAP-tag ligand BG-AF647 (catalog no. S9136S, New England Biolabs), 1 mM DTT (catalog no ...
-
bioRxiv - Molecular Biology 2023Quote: ... that can base pair to the 3’ nucleotide of the cDNA products as described.75,76 The reaction was stopped by adding proteinase K (1 unit; New England Biolabs) and 25 mM EDTA followed by clean-up with a Monarch PCR & DNA Cleanup Kit (New England Biolabs) ...
-
bioRxiv - Immunology 2024Quote: ... MO were stored at 4°C in water at 1 mM and diluted for injections with 0.5X CutSmart Buffer (NEB) and 0.1% phenol red ...
-
bioRxiv - Biochemistry 2024Quote: ... and clarified by centrifugation at 16,100 x g for 1hr and incubated with ∼1 mL of pre-equilibrated compact amylose affinity resin beads (NEB). The resin was washed three times with buffer H ...
-
bioRxiv - Microbiology 2024Quote: ... a 30 uL aliquot of lysate was transferred to a clean 1.5 mL microcentrifuge tube and incubated with 1 uL Endo-H (NEB) for 45 min in a 37C bead bath ...
-
bioRxiv - Microbiology 2024Quote: ... Flanking regions of 1 kb on either side of the target gene were PCR amplified using Q5 polymerase (NEB) and cloned into pLGB13 using the NEBuilder HiFi cloning kit (NEB) ...
-
bioRxiv - Molecular Biology 2024Quote: ... A 1:200 dilution of the double-stranded gRNA was ligated into BsmBI-digested plasmids using T4 ligase (NEB). One µL of the ligated vector was then transformed into chemically competent XL Gold E ...
-
bioRxiv - Molecular Biology 2024Quote: 1 µl of DMS-modified RNA was reverse transcribed in 20 µl using Induro Reverse Transcriptase (New England Biolabs) according to the manufacturer’s protocol with 500 nM of primer CTTCGTCCTTTTCTTGGAAGCGACA (Integrated DNA Technologies ...
-
bioRxiv - Plant Biology 2024Quote: ... 0.81 nmol LbCas12U protein and 0.45 nmol of each of three crRNAs were assembled in 1 x Nuclease Reaction Buffer (NEB). Protein and crRNAs were mixed and incubated for 10 min at room temperature ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... were split into two equal samples and incubated at 50°C for 25 minutes with exonuclease 1 (NEB, M0293) to remove unintegrated barcoded transposon adapters ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 20 mM Tris-acetate, 10 mM magnesium acetate, 100 μg mL−1 BSA at pH 7.9; New England Biolabs). The reactions were incubated at 37 °C for 20-45 min ...
-
bioRxiv - Synthetic Biology 2024Quote: ... All reactions were then digested with 1 µl ExoI and purified using the Monarch DNA Gel Extraction Kit (NEB), eluting in 10 µl of elution buffer (10 mM Tris•Cl pH 7.4) ...
-
bioRxiv - Plant Biology 2020Quote: ... and cDNA was synthesized from 1 µg of total RNA using ProtoScriptR II Reverse Transcriptase (New England BioLabs, MA, USA) in 20 µl reaction with oligo (dT ...