Labshake search
Citations for New England Biolabs :
2701 - 2750 of 3282 citations for Herpes Simplex Virus 1 Antigen since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... Each fragment was PCR amplified using the primers listed in Supplementary Table 1 and was cloned into the pCAMBIA1300 using the T4 DNA ligase (NEB). The construct was transformed into the atalkbh9b-1 mutant and the transgenic lines were identified for homozygosity at T3 generation.
-
bioRxiv - Plant Biology 2022Quote: ... The cell lysate was collected and incubated for 1 h with 2 ml of 50% slurry of chitin resin (New England Biolabs) before loading onto an empty EconoPac gravity-flow column (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2022Quote: ... Institut Jacques Boy), recombinant human IL-2 (rhIL2, 10 U/ml, Miltenyi) and DNase (1 U/ml, New England Biolabs), washed and enumerated ...
-
bioRxiv - Molecular Biology 2022Quote: ... The fragmented RNA was mixed with Protein G Magnetic bead prebound monoclonal anti-m6A antibody (1 µL) from the EpiMark N6-Methyladenosine Enrichment Kit (New England Biolabs), resuspended in 300 µl EpiMark IP buffer supplemented with murine RNase inhibitor (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Illumina multiplex and bar code primers were added by PCR (1 µL of MMEJ product and 200 nM primers in Phusion High-Fidelity PCR Master Mix (New England Biolabs) with 98°C ...
-
bioRxiv - Microbiology 2022Quote: ... xanthus cells grown on 1.5% agar supplemented with 1% CTwas extracted using the Monarch Total RNA Miniprep Kit (New England Biolabs (NEB)) ...
-
bioRxiv - Microbiology 2022Quote: ... The Guide RNAs were synthesised from Sigma and reconstituted by mixing 10 μM of the forward and reverse strands for each guide with 1 μl of 10X ligation buffer (NEB), 0.5 μl T4 polynucleotide kinase (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... 3 μL of 5’ adenylated linkers (Table S3) were added (33 pmol/μL) along with 1 μL T4 RNA ligase 2 truncated (New England BioLabs) and incubated at 25°C for 2.5 hours ...
-
Promoter-adjacent DNA hypermethylation can downmodulate gene expression: TBX15 in the muscle lineagebioRxiv - Molecular Biology 2022Quote: ... by incubating the DNA construct (1 μg) with 4 units of SssI methylase and 160 μM S-adenosylmethionine (New England Biolabs) for 4 h at 37°C or mock-methylating by incubating in the absence of S-adenosylmethionine ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The YeastFab assembly is performed according to the reaction system below: 1 μL 10X Buffer for T4 DNA Ligase (NEB), 0.1 μL Purified BSA 100X (Thermo) ...
-
bioRxiv - Molecular Biology 2023Quote: ... added to 200 μl of 2.5% (v/v) of MagStrep “type3” XT beads (IBA Lifescience) that has been blocked overnight with 1 mg/ml BSA (NEB) and 0.5 mg/ml tRNA (SigmaAlrich ...
-
bioRxiv - Molecular Biology 2023Quote: ... 20 pmol of this RNA was 5’-end-labelled (20 µCi of 32P-γATP) using 1 U of polynucleotide kinase (NEB) at 37°C for 1 h in a 20 µL reaction ...
-
bioRxiv - Molecular Biology 2023Quote: ... increasing volumes of SPRI beads were mixed with 1 μl of a 4-fold dilution of 100 bp DNA ladder (New England Biolabs) and diluted to a final volume of 100 μl with 10 mM Tris-HCl (pH 8.0) ...
-
bioRxiv - Immunology 2022Quote: ... Then 13 μl PCR heteroduplexes were digested by 2 μl of 1 U/μL T7 Endonuclease I (New England Biolabs) at 37°C for 60 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNase-treated RNA was ligated with a 5’-hydroxylated ‘Processed Start Site’ (PSS) RNA adaptor oligomers (onkh031) by RNA Ligase 1 (Promega or NEB) and then purified to remove excess oligomers (NEB Monarch RNA Cleanup kit) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Supernatant was incubated for 1 h with 50 µL anti-V5-tag mAb-Magnetic beads (#M167-11, MBL) blocked with 1 mg/mL BSA (#B9000S, New England Biolabs). Beads were washed seven times with lysis buffer ...
-
bioRxiv - Molecular Biology 2022Quote: ... 20 pmol of dephosphorylated and purified RNA was 5′ end-labeled (20 μCi of 32P-γATP) using 1 U of Polynucleotide Kinase (NEB) for 1 h at 37 °C in a 20 μL reaction volume ...
-
bioRxiv - Molecular Biology 2022Quote: ... The lysate obtained from lysis with 1% NP-40 lysis buffer phosphatase inhibitor were mixed with lambda phosphatase (New England Biolabs) and incubated at 30°C for 2 hours ...
-
bioRxiv - Microbiology 2022Quote: ... shRNA oligos targeting ORF45 listed in Table 1 were then annealed and ligated into the vector using T4 DNA ligase (New England Biolabs) and transformed into Escherichia coli XL-1 Blue cells ...
-
bioRxiv - Molecular Biology 2022Quote: Crushed lungs were homogenized using a mechanical homogenizer (Omni International, Waterbury CT) or cultured cells were lysed in 1× lysis buffer (9803S, NEB) (20 mM Tris-HCl buffer (pH 7.5 ...
-
bioRxiv - Plant Biology 2022Quote: PCR-generated fragments of the CNX1 and CNX2 genomic regions lacking stop codons and including the 1-kbp promoter regions were obtained using Phusion HF DNA polymerase (New England Biolabs), inserted into pENTR-2B ...
-
bioRxiv - Immunology 2022Quote: ... the pools of insert 1 and the pools of insert 2 were assembled using NEBuilder HiFi DNA Assembly Master Mix (NEB). The assembled product was bead-purified using Sera-Mag SpeedBeads (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2024Quote: ... and 0.5% (vol/vol) Triton X-100 in nuclease-free water and 1% (vol/vol) proteinase K (New England Biolabs, P8107S). The sample was digested in this buffer for ≥36h in a humidified ...
-
bioRxiv - Synthetic Biology 2024Quote: ... pSpy0K6 and p7INT.1 was extracted using the Monarch® HMW DNA Extraction Kit for Tissue (New England Biolabs®) according to the manufacturers protocol for Gram-positive bacteria (low input ...
-
bioRxiv - Systems Biology 2024Quote: ... Libraries were generated from 1 μg DNA per sample using the NEBNext Ultra DNA Library Prep Kit (NEB #E7645, USA) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... One µL of the end- prepped DNA was amplicons were barcoded with 1 µL of Nanopore Native Barcode using 5 µL Blunt/TA ligase master mix (NEB) in total reaction volume of 10 µL for 20 min at 20 °C ...
-
bioRxiv - Developmental Biology 2024Quote: ... Purified digested vector and inserts were ligated in a 1:30 vector/insert ratio using the T4 DNA ligase (New England Biolabs) following manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1% sodium dodecyl sulfate) and reverse crosslinked with proteinase K overnight at 65C and subsequently treated with RNAse A (NEB) for 1 hour at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... or 1 µL of nuclease P1 (100,000 U/mL) (New England Biolabs, Fig. 2f and Extended Data Fig. 2c,d) were treated with 1.5 of 10× TURBO DNase buffer or nuclease P1 buffer in the sample by adjusting with Milli-Q H2O to total 15 µL ...
-
bioRxiv - Neuroscience 2024Quote: ... DIG- and FITC-labeled antisense RNA probes were generated from 1 µg of linearized plasmid template using T7 or Sp6 RNA polymerases (NEB) and DIG-11-UTP (Roche) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 μL of the DNAse digestion product was then treated with 1 μL of Proteinase K (New England Biolabs, P8107S) in UltraPure water for a total reaction volume of 20 μL ...
-
bioRxiv - Microbiology 2024Quote: ... The linearized vector and PCR-amplified sequences were mixed at a 1:2 molar ratio and assembled using the NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... To do this 2.5 uL of cutsmart buffer was added to 20 uL of purified PCR product and then 1 uL of DpnI (NEB) was added ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA/sgRNA/Cas9 ratios of 1/10/10 were used in a 10 µl reaction using the buffer supplied (NEB) and DEPC-treated water (Haussmann et al ...
-
Human immunodeficiency virus-1 induces and targets host genomic R-loops for viral genome integrationbioRxiv - Molecular Biology 2024Quote: ... The slides were washed three times with 1× PBS and incubated with or without 60 U/mL RNase H (M0297S, NEB) at 37°C for 36 h or left untreated ...
-
bioRxiv - Microbiology 2024Quote: ... The HIV-1AC-1 mutations were introduced into WT and N74D pNLdE-luc using the Gibson Assembly Cloning kit (New England Biolabs) and primers shown in Table S1 ...
-
bioRxiv - Microbiology 2024Quote: ... an inverse PCR was performed using R3-p21 and the oligonucleotides ToANV-rectest-For/ToANV-rectest-Rev (Supplementary Table 1) using Phusion High-Fidelity DNA Polymerase (New England BioLabs) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µg of total RNA was used for standard library preparation using NEBNext PolyA mRNA magnetic isolation module (NEB, E7490). In brief ...
-
bioRxiv - Immunology 2024Quote: ... To subclone this pool we digested our protospacer-empty Libr.1-null transfer vector with BsmBI-v2 (New England Biolabs, NEB) overnight at 55 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... at 37 °C for 1 h and ligated to a 3′ adaptor sequence using T4 RNA ligase 2 (truncated K227Q, New England Biolabs) at 22 °C for 3 h ...
-
bioRxiv - Microbiology 2023Quote: The eluted gDNA was resuspended by pipetting to make the beads and elution as homogenous as possible before 20 µL was used in a 40 µL digest using 1 µL of nucleoside digestion mix and 4 µL 10X buffer following the protocol for Nucleoside Digestion Mix (NEB) in an unskirted PCR plate ...
-
bioRxiv - Microbiology 2024Quote: ... and used as a template for barcode amplification in a 1-step PCR with Q5 polymerase with high-GC buffer (NEB). Indexed samples were sequenced on a NextSeq 550 in high-output mode (Donnelly Centre ...
-
bioRxiv - Microbiology 2024Quote: ... The radioactive probe was prepared from 40 pmoles of D072 primer (Table 1) and labeled at the 5’ end with 10 units of T4 polynucleotide kinase (New England Biolabs) and [γ-32P]-ATP (150 μCi) ...
-
bioRxiv - Cell Biology 2024Quote: THP-1 monocytes were harvested and lysed for RNA extraction using the Monarch Total RNA Miniprep kit (New England Biolabs), according to the manufacturer protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... a five-fold molar excess of oligonucleotides bearing either 8-oxo-G or G was mixed with the phage-extracted circular single-stranded DNA in 1=×=Phusion HF Buffer (New England BioLabs). After denaturation at 90=°C for 2=min followed by rapid cooling ...
-
bioRxiv - Biophysics 2024Quote: We assembled mutant libraries by combining the linearized sensor backbone with each oligo subpool at a molar ratio of 1:5 using Golden Gate Assembly Kit (New England Biolabs; 37 ◦C for 5 min and 60 ◦C for 5 min ...
-
bioRxiv - Biochemistry 2024Quote: ... 3’ adapters with 5’-adenylated RNA adapter (see 3’ adapters in table below) were ligated to the recovered small RNAs using Rnl2(1-249)K227Q RNA ligase (M0351, New England Biolabs) according to the manufacturer’s instructions at 4°C overnight with shaking ...
-
bioRxiv - Cell Biology 2024Quote: ... and incubated with 200 µM ATP with ot without 1 µl of recombinant PKA catalytic subunit (PKAc; New England Biolabs) in manufacturer-supplied reaction buffer at 30° C for 30min with agitation ...
-
bioRxiv - Cell Biology 2024Quote: ... with primers BA3187/BA3188 and cloned into RSFDuet-1 using BamHI/EcoRI sites with the NEBuilder HiFi DNA Assembly kit (NEB) (Table S1) ...
-
bioRxiv - Cell Biology 2023Quote: ... the KCNJ16 gene was amplified with 1× Q5 Hot Start High-Fidelity master mix (New England Biolabs, Ipswich, United Kingdom), 0.5 μM forward primer (‘5-‘3 CTACCCGCCAGAGCACATTAT ...