Labshake search
Citations for New England Biolabs :
2701 - 2750 of 3392 citations for 2 4 Methoxyethoxy 3 methyl 2 pyridinyl methylthio benzimidazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... the fragments were repaired and A-tailed using 15 units of Klenow 3’-5’ exo-(New England Biolabs). After End-repair and A-tailing ...
-
bioRxiv - Cell Biology 2024Quote: ... Full length human NHSL1-A1 including Exon 1a and excluding exons 3 and 6 was generated by NEB HIFI assembly using a synthetic DNA fragment (gBlocksTM ...
-
bioRxiv - Molecular Biology 2021Quote: ... Reverse transcription was initiated by adding 4 μl of 5× ProtoScript II Buffer (New England Biolabs), 2 μl of 0.1 M DTT ...
-
bioRxiv - Biophysics 2020Quote: ... the 5’ end of the 4 kb transcript was biotin-labeled using Vaccinia Capping System (NEB) and 3-biotin-GTP (NEB ...
-
bioRxiv - Biophysics 2021Quote: ... Primers were designed for the replacement of each of the 4 loops using Q5 polymerase (NEB) PCR reaction and a KLD enzyme mix (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... after ligation overnight at 4°C with the T4 DNA ligase (New England Biolabs, Evry, France).The sequences of the cloned fragments in the resulting plasmids pYES2::MlpCSP1 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 4 mM DTT) supplemented with 200 μM cold SAM (S- adenosyl methionine) (NEB; for immunoblotting) or 1 µCi 3H-labelled SAM (PerkinElmer ...
-
bioRxiv - Genetics 2022Quote: ... Donor 4) were combined in a single ligation reaction using T4 DNA Ligase (New England Biolabs) according to the manufacturer’s instructions and incubated overnight at 16°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... the extension enzyme was replaced with 4 units of Bst 2.0 Warmstart DNA Polymerase (NEB, Cat.No.M0538). Correspondingly ...
-
bioRxiv - Molecular Biology 2020Quote: ... an end-repair mastermix was made by combining 4 μl T4 DNA Ligase Reaction Buffer (NEB), 0.5 μl dNTP (10mM ...
-
bioRxiv - Neuroscience 2020Quote: ... After overnight incubation at 4°C in PBS-Perm with rabbit anti-GFP (1:1000, Biolabs) and mouse anti-MAP2 (1:2000 ...
-
bioRxiv - Plant Biology 2023Quote: ... 10 ul of diluted DNA were used for McrBC digestion (NEB, 4 h at 37 °C) or mock digestion (the same volume of H2O instead of McrBC enzyme was added with all other components the same in the reaction ...
-
bioRxiv - Genomics 2024Quote: ... 4 μg of the barcoded plasmid library was linearized by digestion with NruI-HF (NEB #R3192) at 37°C for 16 hours ...
-
bioRxiv - Plant Biology 2023Quote: ... 4 pmol of double-stranded DNA was labeled with 1 unit of Klenow fragment polymerase (NEB) and 8 pmol Cy5-dCTP (Cytiva ...
-
bioRxiv - Genomics 2023Quote: ... 20 µg of total RNA was then treated with 4 units of DNAse I (NEB, #M0303S) for 1 h at 37°C ...
-
bioRxiv - Bioengineering 2023Quote: ... The 4 targeted CDRs were amplified by error-prone PCR using Taq polymerase (New England Biolabs), 1× Taq buffer (New England Biolabs) ...
-
bioRxiv - Cell Biology 2023Quote: ... 4 % cDNA product was used to perform semiquantitative PCR using 50 % Taq MM (New England Biolabs) and 0.5 µM of the forward (GAACCAGGAGTTAAGAACACG ...
-
bioRxiv - Genetics 2023Quote: ... and NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs Set 4) (NEB, E6446S) as index primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... Oligos were 5’-end radiolabeled at a final concentration of 4 μM with T4 PNK (NEB) and γ-32P-ATP after incubation for one hour at 37°C followed by enzyme inactivation at 72°C for 10 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... for which the completed ligation reaction was treated with 4 µL RecJf (New England Biolabs, M0264L) and 3 µL 5ʹ Deadenylase (New England Biolabs ...
-
bioRxiv - Genomics 2023Quote: ... Charles Gersbach) was PCR amplified (primers in Extended Data Table 4) and cloned into KpnI(NEB)-digested pLV-hUbC-dSpCas9-2xVP64-T2A-BSD via blunt-end ligation cloning (NEB) ...
-
bioRxiv - Genomics 2024Quote: ... 4 µg of each sample was reverse transcribed using dT priming with Protoscript II (NEB, M0368L) and subsequently treated with 0.5 µL each of Rnase H and Rnase A (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 mM UTP and 1 mM GTP and 4 mM ARCA (Anti-Reverse Cap Analog) (NEB)) ...
-
bioRxiv - Genetics 2024Quote: ... Plugs were then equilibrated in NEBuffer 4 and treated with 75 U of exonuclease T (NEB) for 90 min at 24 °C.
-
bioRxiv - Biochemistry 2024Quote: ... Alkaline phosphatase treatment was performed over night at 4°C using Lambda Protein Phosphatase (#P0753S, BioLabs).
-
bioRxiv - Genetics 2024Quote: ... 4) IDS-KO receiving 1 mg/kg idursulfase IV and nebulized idursulfase (KO-NEB, n = 5). The nebulized idursulfase was delivered as 167 µL of 2 mg/mL ...
-
bioRxiv - Microbiology 2020Quote: ... and a “bottom” strand with sequence 5’-AAAAC-(30bp spacer reverse complement)-3’ were phosphorylated with PNK (NEB, M0201S) in a 50 μL reaction volume (1.5 μL 100 uM top oligo ...
-
bioRxiv - Microbiology 2020Quote: ... RNA and 3′ adapters were incubated at 22°C for 2.5 hr with 51 U of T4 RNA Ligase I (NEB) and 12 U of recombinant RNase inhibitor (Takara Bio ...
-
bioRxiv - Biochemistry 2021Quote: ... The fragment was ligated into the pLSV101 vector (3:1 molar ratio) with T4 DNA ligase (New England Biolabs) (16 °C overnight) ...
-
bioRxiv - Molecular Biology 2021Quote: ... before incubation during 6 min in 50μl of PNK reaction mix (1x PNKT, 1 mM ATP and 0.05 U/ml T4 PNK 3′phosphatase minus (NEB) in a thermomixer at 37°C and 1400rpm ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 5’ end of the first block and the 3’ end of the last block contained SapI (NEB, R0569) recognition sites instead ...
-
bioRxiv - Genetics 2022Quote: ... Pddx-23::ceDDX23::ddx-23 3’UTR (nEx2971 and nEx2972) was generated by HiFi DNA Assembly (New England Biolabs) of Pddx-23 ...
-
bioRxiv - Biochemistry 2021Quote: ... samples were incubated for 1 h at 37°C with 1 µl Endo H in GlycoBuffer 3 (NEB P0702S) after denaturing in SDS sample buffer prior to running SDS-PAGE.
-
bioRxiv - Microbiology 2021Quote: ... the THN gene was ligated to pICH41021 in a 3:1 molar ratio using T4 Ligase (New England Biolabs) at 4°C overnight and transformed by heat shock into chemically competent E ...
-
bioRxiv - Molecular Biology 2020Quote: ... Selectively captured polyadenylated RNAs (1μg) were ligated directly to an DNA/RNA hybrid adapter (5’-CTACAC GACGCTrCrUrUrCrCrGrArUrCrUrNrNrN-3’) using T4 RNA ligase (NEB) at 37°C for 30 minutes ...
-
bioRxiv - Cancer Biology 2022Quote: ... Ligation of the 3’ adapter was done using the T4 RNA Ligase 1 (New England Biolabs, Ipswich, MA, M0204L). Ligation of 5’ adaptor required (i ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 3’ terminus of total RNAs were ligated with the irCLIP adaptor by T4 RNA Ligase 1 (NEB, M0437M). After ligation ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 20 minutes at 80 °C followed by adding annealed inserts to vector DNA (0.020 pmol) at a 3:1 molar ratio with T4 DNA ligase (400 units; M0202S, New England Biolabs), T4 DNA ligase buffer and nuclease free water to a final volume of 20 μL for 30 minutes at room temperature and then 65 °C for 10 minutes.
-
bioRxiv - Microbiology 2020Quote: pCrPV-3 and pCrPV-1A-DcDV-1A were linearized by digestion with BamHI-HF (New England Biolabs, Ipswich, Massachusetts). Wild-type and CrPV-DcDV RNA was prepared by in vitro transcription of 1 µg linearized plasmid using the mMESSAGE mMACHINE T7 transcription kit (Invitrogen ...
-
bioRxiv - Systems Biology 2020Quote: 3’ ends of the RNA fragments were dephosphorylated using 0.5 U μl−1 calf intestinal phosphatase (New England Biolabs) for 10 min at 37°C ...
-
bioRxiv - Neuroscience 2020Quote: ... unc-116::tagRFP::tom7 including unc-54 3’-UTR was PCR amplified using Phusion polymerase (NEB, Ipswich, MA, USA) from unc29p::unc-116::tagRFP::tom7 using following primers ...
-
bioRxiv - Cell Biology 2021Quote: ... Par-3 PDZ1-APM and PDZ1-APMΔPDZ2 were first his-purified (described above) prior to incubation with amylose resin (NEB). Amylose-bound Par-3 was then washed and resuspended in binding buffer as described for GST proteins.
-
bioRxiv - Cell Biology 2020Quote: PCR amplification of short fragments for screening purposes (<3 kbp) was conducted using OneTaq® (New England Bolabs (NEB), Ipswich ...
-
bioRxiv - Biochemistry 2021Quote: ... Construct included 5’ and 3’ complementary overhangs for ligation into pPICZαA using NEBuilder HiFi DNA Assembly (New England Biolabs) to form pPICZαA_GH43_34 ...
-
bioRxiv - Systems Biology 2021Quote: ... 3 μL of the reverse phasing primer pool (100 nM) and 15 μL of Q5 Mastermix (New England Biolabs). Cycle conditions were 4 minutes at 98°C followed by 20x (30 seconds at 98°C ...
-
bioRxiv - Plant Biology 2021Quote: ... samples were incubated for 5 min on ice and 3 μL of 10X G5 buffer (New England BioLabs, UK) were added to the samples together with 1.5 μL of 25X concentrated protease inhibitor cocktail (Roche ...
-
bioRxiv - Cell Biology 2021Quote: ... The tubes were cooled at 42 °C for 10 min before addition of 3 μl of β-agarase (NEB) dissolved in 100 μl MES solution ...
-
bioRxiv - Genomics 2022Quote: The crRNAs and tracRNA (see Extended Table 3) were mixed 1:1 to 1 μM in supplied buffer 3.1 (NEB) with 0.2 U/μl RNaseOUT™ (Invitrogen) ...
-
bioRxiv - Genomics 2022Quote: ... and water to make up 49 µl) for three hours at 37°C after which 3 µl NlaII (NEB) was added and the reaction incubated at 37°C for a further three hours ...
-
bioRxiv - Molecular Biology 2023Quote: ... Purified mIL-12bC197S-His6 in complex with mIL-12Rβ1D1-D2-His6 was subjected to an overnight Caspase-3 and EndoH (New England Biolabs) digest (1/100 w/w ...