Labshake search
Citations for New England Biolabs :
2651 - 2700 of 9425 citations for Mouse Plectin PLEC ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... the IVT products were purified with Monarch RNA purification kits (New England Biolabs, NEB), and the purified RNA was quantified using a nanophotometer (IMPLEN) ...
-
bioRxiv - Genomics 2023Quote: ... PCR was performed with the Phusion High-Fidelity PCR kit (E0553L, New England BioLabs) with the following cycling conditions ...
-
bioRxiv - Molecular Biology 2023Quote: ... The transcripts were purified with a Monarch RNA Cleanup kit (New England Biolabs, USA). The RNA annealing reaction containing 10 mM Tris-HCl (pH 7.4 at 25°C) ...
-
bioRxiv - Molecular Biology 2023Quote: ... for mRNA enrichment and Ultra II directional RNA Library Prep Kit (NEB, Cat# E7760) following the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the cDNA libraries were purified using the Monarch PCR & DNA Cleanup Kit (NEB). High-throughput sequencing was performed on an Illumina NextSeq 550 in paired-end mode with 150 cycles per end.
-
bioRxiv - Molecular Biology 2023Quote: ... transferred to 50 μl DNA/RNA protection buffer (Monarch Total RNA Miniprep Kit, NEB), and stored in liquid N2 ...
-
bioRxiv - Neuroscience 2023Quote: ... Sequencing libraries were generated using NEBNext UltraTM RNA Library Prep Kit for Illumina (NEB) following manufacturer’s recommendations and index codes were added to attribute sequences to each sample ...
-
bioRxiv - Neuroscience 2023Quote: ... Ribosomal RNA was depleted from total RNA with the rRNA depletion kit (NEB# E6310) and subsequently prepared for RNA-seq with the NEBNext Ultra Directional RNA Library Prep Kit (NEB #E7420 ...
-
bioRxiv - Biophysics 2023Quote: RNA synthesis was performed according to the HiScribe SP6 RNA Synthesis Kit protocol (NEB). Double-stranded DNA sequences containing SP6 promoter 5′ATTTAGGTGTGACACTATAG 3′ were used as DNA matrixes for RNA transcription.
-
bioRxiv - Bioengineering 2023Quote: ... Ph.D.™-12 Phage Display Peptide Library Kit (New England BioLabs□ Inc., MA, USA) was preferred ...
-
bioRxiv - Bioengineering 2023Quote: ... Ph.D.™-12 Phage Display Peptide Library Kit (New England BioLabs□ Inc., MA, USA) was used ...
-
bioRxiv - Biophysics 2023Quote: ... The NEBuilder HiFi DNA Assembly and Q5 site-directed mutagenesis kits (New England Biolabs) were used for plasmid construction ...
-
bioRxiv - Biochemistry 2023Quote: ... All disease variants were introduced using a Q5 site-directed mutagenesis kit (NEB, E0554S).
-
bioRxiv - Molecular Biology 2023Quote: Libraries for ChIP-seq were prepared with NEBNext Ultra II DNA Library kit (NEB) according to the manufacturer’s instructions with the following modifications ...
-
bioRxiv - Cancer Biology 2023Quote: ... Gel purification using the Monarch DNA Gel Extraction Kit (New England BioLabs Inc. #T1020L) was performed to extract the shRNA sequence and column purification with the QIAprep PCR Purification Kit (Qiagen #28104 ...
-
bioRxiv - Immunology 2023Quote: ... followed by the NEBNext Ultra II Directional RNA Library Prep Kit (CAS: E7760S, NEB). Completed libraries were then sequenced to an average depth of approximately 20M reads per sample on a partial lane of the NovaSeq6000 S4 XP flow cell using 2×150 paired-end reads with 10-base dual indexes (CAS ...
-
bioRxiv - Developmental Biology 2023Quote: ... were carried out using the NEBridge Golden Gate Assembly Kit (BsmBI-v2) (NEB, #E1602L), using 75 ng of each part and 2 μl of enzyme mix in a 20 μl reaction ...
-
bioRxiv - Microbiology 2023Quote: ... the PCR reaction was purified using the Monarch PCR Cleanup Kit (New England Biolabs). DNA was sent for Sanger sequencing ...
-
bioRxiv - Plant Biology 2023Quote: ... we utilized the NEB Next Ultra DNA Library Prep Kit for Illumina (NEB, USA), following the manufacturer’s guidelines ...
-
bioRxiv - Systems Biology 2023Quote: ... rRNA depletion was performed with the NEBNext rRNA Depletion Kit v2 (New England Biolabs), and total RNA libraries were prepared with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and processed with the NEBNext Ultra II DNA library preparation kit (New England Biolabs). Sequencing was performed on MiSeq sequencers (Illumia) ...
-
bioRxiv - Plant Biology 2024Quote: ... Libraries were prepared using NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2024Quote: ... and NEBNext® Ultra™ ll Directional RNA Library Prep Kit (New England BioLabs) according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2024Quote: ... the library was prepared using the NEBNext DNA Library Prep Kit (New England BioLabs). The constructed library was sequenced on Novaseq 6000 platform (illumina ...
-
bioRxiv - Cell Biology 2024Quote: ... coli cells using the Q5 mutagenesis kit in accordance with the manufacturer’s instructions (NEB). For FACS rescue experiments with WT-CHC22 or 11TD-CHC22 ...
-
bioRxiv - Genetics 2023Quote: ... DNA ends were repaired using the NEBNext FFPE DNA Repair kit (NEB cat# E7180S) following the manufactures directions ...
-
bioRxiv - Molecular Biology 2023Quote: ... The obtained RNA was purified with the Monarch RNA purification kit (New England Biolabs), and reverse transcription (RT ...
-
bioRxiv - Molecular Biology 2023Quote: ... and then purified with a Monarch PCR & DNA Cleanup kit (New England Biolabs, USA). For IVT reactions ...
-
bioRxiv - Microbiology 2024Quote: ... The library kit and type of sequencer were TruSeq Stranded Total RNA (NEB Microbe) and NovaSeq ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Recovery products were then purified with the Monarch® PCR & DNA Cleanup Kit (NEB) and eluted in 10 µl of the Monarch® DNA Elution Buffer ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The library kit and type of sequencer were TruSeq Stranded Total RNA (NEB Microbe) and NovaSeq ...
-
bioRxiv - Genomics 2024Quote: ... The assembly was then purified with the Monarch PCR & DNA cleanup kit (NEB, T1030S), eluted in 6 µL of water ...
-
bioRxiv - Developmental Biology 2024Quote: ... Libraries were prepared using the NEBNext Ultra II Directional kit(NEB, Cat no E7760L) with ribodepletion (Qiagen QIAseq FastSelect -rRNA HMR Kit ...
-
bioRxiv - Genetics 2024Quote: ... PCR amplifications were performed using Phusion High-Fidelity PCR kit (New England Biolabs #M0530L) according to manufacturer’s protocol using 50 ng template DNA per 100µL reaction and 18 cycles ...
-
bioRxiv - Microbiology 2024Quote: ... Sequencing libraries were prepared using the NEBNext Ultra-II RNA kit (New England Biolabs) according to a previously described protocol27 ...
-
bioRxiv - Cell Biology 2024Quote: ... and clean-up performed using Monarch® RNA Cleanup Kit (Biolabs, New England, T2030L).
-
bioRxiv - Cell Biology 2024Quote: ... RNA was then purified using Monarch Total RNA miniprep Kit (New England Biolabs, T2010S) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... The NEBNext® Ultra II Directional RNA Library Prep kit (New England Biolabs, USA) was used for RNA sequencing library construction ...
-
bioRxiv - Microbiology 2024Quote: ... Amplicons were purified using the Monarch DNA and PCR Cleanup Kit (New England Biolabs) and precipitated as per the Co-Precipitant Pink (Bioline ...
-
bioRxiv - Genomics 2024Quote: ... we prepared genomic libraries with the NEBNext Ultra FS II kit (New England Biolabs) and resequenced the whole genomes at the SNP&SEQ Technology Platform in Uppsala ...
-
bioRxiv - Genomics 2024Quote: ... and dual-barcoded using a New England Biolabs Ultra II Directional kit (NEB #E7765). Individually labelled samples were pooled and sequenced using a paired end protocol and a read length of 150bp ...
-
bioRxiv - Cell Biology 2024Quote: Prior to rRNA depletion using the NEBNext rRNA Depletion Kit v2 (New England Biolabs), 1 μg total RNA was mixed with 2 μl 1:100 diluted ERCC RNA Spike-In Mix (Thermo Fisher Scientific) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... were transcribed and purified using HiScribe T7 High Yield Transcription Kit (New England BioLabs) and illustra Microspin G-50 Columns (GE Healthcare Life Sciences) ...
-
bioRxiv - Developmental Biology 2024Quote: ... and RNA was extracted using the Monarch Total RNA Miniprep Kit (New England Biolabs). cDNA was made using iSCRIPT reverse transcriptase (BioRad) ...
-
bioRxiv - Microbiology 2024Quote: ... cDNA was used as a template for PCR (Phusion HF kit (New England Biolabs)) with primers designed to amplify the spike and HE genes (Table 2) ...
-
bioRxiv - Cancer Biology 2024Quote: Total RNA was extracted with the NEB Monarch RNA miniprep kit (NEB cat. T2010S) following manufacturer’s manual with on-column DNA digestion ...
-
bioRxiv - Cell Biology 2024Quote: ... followed by library preparation using NEBNext Ultra II RNA Library Preparation Kit (NEB, E7770S). Libraries were paired-end sequenced with read lengths of 150 bp on Illumina Nova-seq S4 instruments ...
-
bioRxiv - Bioengineering 2024Quote: ... cDNA synthesis was carried out with the LunaScript RT SuperMix Kit (New England Biolabs), using a thermocycler program consisting of a primer annealing stage at 25°C for 2 minutes ...
-
bioRxiv - Cell Biology 2024Quote: ... for neuron infection using the NEBuilder HiFi DNA Assembly Cloning Kit (New England Biolabs). iPSC-derived neurons were infected using viral particles diluted in N2B27 media (5 MOI ...
-
bioRxiv - Genomics 2024Quote: ... rRNA was depleted using the NEBNext® rRNA Depletion Kit (Bacteria) (NEB, MA, US) from 500 ng of total RNA ...