Labshake search
Citations for New England Biolabs :
2551 - 2600 of 9500 citations for QuantiChrom Iron Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... rRNA was removed from the total RNA using a NEBNext rRNA depletion kit (NEB), and RNA was converted to a DNA library using a TruSeq stranded total RNA kit (Illumina) ...
-
bioRxiv - Molecular Biology 2022Quote: ... point mutations were introduced using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... The pME_EB3-mScarlet-I was cloned using the Gibson Assembly cloning kit (NEB #E2611S) according to the manufacturer instruction ...
-
bioRxiv - Systems Biology 2024Quote: ... the enzyme’s activity was immediately neutralised using the Monarch PCR & DNA Cleanup Kit (NEB). Subsequently ...
-
bioRxiv - Synthetic Biology 2023Quote: ... after which DNA was extracted using Monarch genomic DNA purification kit (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and transcribed using the HiScribe T7 High Yield RNA Synthesis Kit (NEB, Cat. # E2040S), template concentration 10 nM ...
-
bioRxiv - Cell Biology 2024Quote: ... coli cells using the Q5 mutagenesis kit in accordance with the manufacturer’s instructions (NEB). For FACS rescue experiments with WT-CHC22 or 11TD-CHC22 ...
-
bioRxiv - Systems Biology 2024Quote: ... PCR products were spin-purified using the Monarch PCR & DNA Cleanup Kit (NEB T1030) or the DNA Clean & Concentrator-5 kit (Zymo Research ...
-
bioRxiv - Synthetic Biology 2024Quote: ... RNA samples were purified using the Monarch® RNA Cleanup Kit (New England Biolabs) following the manufacturer’s instructions.
-
bioRxiv - Plant Biology 2024Quote: ... Libraries were prepared using NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2024Quote: ... the library was prepared using the NEBNext DNA Library Prep Kit (New England BioLabs). The constructed library was sequenced on Novaseq 6000 platform (illumina ...
-
bioRxiv - Genetics 2024Quote: ... and NEBNext® Ultra™ ll Directional RNA Library Prep Kit (New England BioLabs) according to the manufacturer’s protocol ...
-
bioRxiv - Pathology 2024Quote: ... 5 min ice) and plasmids were extracted using the Monarch Plasmid Miniprep kit (NEB) following manufacturer’s instructions.
-
bioRxiv - Developmental Biology 2024Quote: Total RNA was extracted from collected spermatids fractions with Monarch RNA extraction kit (NEB) according to manufacturers’ protocol for RNA extraction from tissue or leukocytes ...
-
bioRxiv - Cell Biology 2024Quote: ... Libraries were prepared using NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB). Libraries were pooled and sequenced with paired end sequencing on a Novoseq 6000 (Novogene).
-
bioRxiv - Developmental Biology 2024Quote: The mRNA isolation utilized the NEBNext Poly(A) mRNA Magnetic Isolation Kit (NEB, #E7490) with 1 μg of total RNA ...
-
bioRxiv - Zoology 2024Quote: ... and pMi{Hau-cif7-ngfp}) were produced using NEBuilder HiFi DNA Assembly kit (NEB). The pMi base plasmid was linearized by double digestion with SpeI and SacII ...
-
bioRxiv - Developmental Biology 2024Quote: ... The gRNAs were synthesized using the HiScribe T7 High Yield RNA Synthesis Kit (NEB) and purified using the Monarch RNA Cleanup Kit (NEB ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Minipreps were performed using Monarch Plasmid Miniprep kit (New England Biolabs, Ipswich, Massachusetts, USA) and PCR products were purified with Monarch PCR and DNA Cleanup kit (New England Biolabs ...
-
bioRxiv - Neuroscience 2024Quote: ... and cDNA was generated using the ProtoScript II Reverse Transcription Kit (New England BioLabs). qPCR was performed on a LightCycler 480 real time PCR system (Roche ...
-
bioRxiv - Developmental Biology 2024Quote: ... RNA libraries were prepared using the NEBNext Ultra Directional RNA Library Prep Kit (NEB) and sequenced on the HiSeq 2500 Sequencing System (Illumina ...
-
bioRxiv - Molecular Biology 2024Quote: ... rRNA depletion was achieved using the NEBNext rRNA depletion kit v2 (NEB, Cat# E7400L), and subsequent end-repair ...
-
bioRxiv - Molecular Biology 2024Quote: ... End prep and adaptor ligation was performed using the Enzymatic Methyl-seq kit (NEB). Conversion was performed identically to the amplicons ...
-
bioRxiv - Microbiology 2024Quote: ... The purified products were quantified using the NEBNext Library Quant kit for Illumina (NEB) and sequenced using a mid-output reagent cartridge with 2×150 paired-end reads on an Illumina Miniseq platform ...
-
bioRxiv - Microbiology 2024Quote: ... cells were lysed and RNA purified using the Monarch Total RNA Miniprep Kit (NEB) according to the manufacturer’s instructions except that the on-column DNase treatment was omitted ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries were prepared using NEBNext Ultra II DNA Library prep kit (New England Biolabs) following manufacturer’s instructions for H3K9ac CUT&RUN DNA ...
-
bioRxiv - Microbiology 2024Quote: ... the linear plasmid was blunted by digestion with Quick Blunting™ Kit (NEB, USA) and ligated to re-circularize the plasmid ...
-
bioRxiv - Microbiology 2024Quote: ... the NEB OneTaq® One-Step RT-PCR Kit (New England Biolabs, Product # E5315S) was used to target the haemagglutinin gene ...
-
bioRxiv - Microbiology 2024Quote: ... First-strand cDNA was synthesized using ProtoScript II first strand cDNA synthesis kit (NEB), and quantitative real-time PCR was performed on QuantStudio 3 real-time PCR system (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2024Quote: RNA was extracted using the Monarch Total RNA miniprep kit (New England Biotechnologies (NEB) #T2010 ...
-
bioRxiv - Molecular Biology 2024Quote: ... the library for sequencing was constructed with FS DNA Library Prep Kit (NEB, E7805) by following the manual instructions ...
-
bioRxiv - Microbiology 2024Quote: ... The 3p-v4 oligo was 5′ adenylated using 5′ DNA Adenylation Kit (E2610S, NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA (>300 ng) was reverse transcribed using the Lunascript RT Supermix Kit (NEB, E3010).
-
bioRxiv - Developmental Biology 2024Quote: ... and then immediately followed by Library prep using NEBNext Ultra II kit (NEB, E7770). Libraries were pooled and sequenced using a H75 kit from Illumina in a NextSeq500 sequencer following manufacturer’s instructions.
-
bioRxiv - Biophysics 2024Quote: ... Libraries were prepared using NEBNext ultra II DNA library kit for Illumina (NEB Biolabs) according to the manufacturer instructions ...
-
bioRxiv - Biophysics 2024Quote: ... Libraries were prepared using NEBNext ultra II DNA library kit for Illumina (NEB Biolabs) according to the manufacturer instructions ...
-
bioRxiv - Microbiology 2024Quote: ... The resulting RNA was purified using the Monarch RNA cleanup kit (New England Biolabs) and analyzed by agarose gel electrophoresis.
-
bioRxiv - Developmental Biology 2024Quote: ... Libraries were quantified using NEBNext® kit for Illumina® (New England Biolabs, E7630S), pooled at equimolar amounts ...
-
bioRxiv - Cell Biology 2023Quote: ... All amplified fragments were then combined using Gibson assembly (Gibson assembly cloning kit, NEB) with 20 base pair overhangs ...
-
bioRxiv - Synthetic Biology 2023Quote: ... RNA was extracted first using a Monarch® Total RNA Miniprep Kit (NEB T2010) with on-column DNAse digestion ...
-
bioRxiv - Microbiology 2024Quote: Deletion of vpr was achieved using Q5 Site-Directed Mutagenesis kit (New England Biolabs) where the majority of the vpr coding sequence was deleted using PCR exclusion (forward - CAGAATTGGGTGTCGACATAG ...
-
bioRxiv - Synthetic Biology 2024Quote: ... while Gibson assembly reactions used the NEBuilder(R) HiFi DNA Assembly Cloning Kit (NEB). Transformed bacteria were grown for 24h at 32°C ...
-
bioRxiv - Zoology 2023Quote: ... or the Genome Institute of Singapore (GIS) using NEBNext DNA Library Preparation Kits (NEB). Paired-end sequencing was performed on Illumina Miseq (2x300-bp or 2x250-bp ...
-
bioRxiv - Immunology 2024Quote: ... Gibson assembly was performed using the NEBuilder HiFi DNA Assembly kit (New England Biolabs). 100 ng/μl of pET770 was co-injected along with a body wall muscle co-injection marker (17 ng/μl ...
-
bioRxiv - Genetics 2024Quote: ... cDNA synthesis was performed using the ProtoScript® First Strand cDNA Synthesis Kit (NEB). One microliter of oligo d(T)23VN primer (50 μM ...
-
bioRxiv - Genetics 2024Quote: ... followed by in vitro transcription with the T7 High Yield RNA Synthesis kit (NEB). Newly synthesized sgRNAs were purified using the MEGAclear kit (Life Technologies) ...
-
bioRxiv - Genomics 2024Quote: The ligation product was purified using a Monarch PCR & DNA Cleanup Kit (NEB #T1030) following the manufacturer’s recommended protocol ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... pBBR1-E and pBBR-EV were extracted using Monarch Plasmid Miniprep kit (#T1010; NEB) and following supplier’s instructions ...
-
bioRxiv - Genetics 2024Quote: ... immunoprecipitated RNA and 1% input RNA Monarch RNA Cleanup Kit (New England Biolabs, T2047L) was used according to the manufacturers’ instructions ...
-
bioRxiv - Immunology 2024Quote: ... and converted into Illumina sequencing libraries with the NEBNext Small RNA Library kit (NEB). Libraries were sequenced on the Illumina NextSeq-550 in the Boston University Microarray and Sequencing Core ...