Labshake search
Citations for New England Biolabs :
2551 - 2600 of 10000+ citations for Mouse Acrosomal Protein SP 10 ACRV1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... myc-tagged AP3B1 immunoprecipitated and immobilised on Protein G-sepharose beads was incubated with CK2 (250 units; New England Biolabs) for 30 min ...
-
bioRxiv - Biophysics 2024Quote: ... In vitro pull-down binding assays were performed in triplicate by incubating proteins at their indicated concentrations with 20 µL amylose resin (bead bed volume; New England Biolabs) in a 200 µL reaction in Assay Buffer (20 mM HEPES pH 7.4 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Protein-coding or lncRNA genes with adjusted P-value < 0.05 and absolute log2 fold change > 1 (NEB Directional RNA-seq) or with adjusted P-value < 0.05 and absolute log2 fold change > 0 (QuantSeq 3’ mRNA-seq ...
-
bioRxiv - Cell Biology 2024Quote: ... Reactions were quenched by addition of EDTA to 50 mM and proteins were removed by treatment with proteinase K (20 units/ml) (NEB) and SDS (0.25% ...
-
bioRxiv - Plant Biology 2024Quote: ... MBP-RVE4 and MBP-RVE8 proteins were expressed in Escherichia coli BL21 strain according to the manufacturer’s instructions using the pMAL Protein Fusion and Purification System (New England Biolabs; #E8200) and purified using MBPtrap HP column (Cytiva ...
-
bioRxiv - Biochemistry 2024Quote: PamB2-ribosome complexes were generated by in vitro transcription-translation reactions in PURExpress in vitro protein synthesis system (New England Biolabs) with the same reaction mix as described earlier in the toeprinting assays ...
-
bioRxiv - Molecular Biology 2024Quote: ... The pRL814 (containing green fluorescent protein (GFP) under control of PT7A1-O34) backbone was digested with NdeI and HindIII-HF (NEB). The digested backbone and amplified genes were ligated using NEBuilder HiFi DNA Assembly Master Mix (NEB ...
-
bioRxiv - Microbiology 2024Quote: ... SINV-REP construct derived from pToto64 clone encoding SINV non-structural proteins and a reporter luciferase tag was linearized using SacI (New England Biolabs), followed by in vitro transcription using SP6 RNA polymerase (New England Biolabs) ...
-
bioRxiv - Developmental Biology 2024Quote: ... The Cas9-sgRNA ribonucleoprotein complex (RNP) solution was prepared as follows: Cas9 protein (EnGen® Spy Cas9 NLS, NEB, M0646T) 1.3μl ...
-
bioRxiv - Cell Biology 2024Quote: ... Reactions were quenched by addition of EDTA to 50 mM and proteins were removed by treatment with proteinase K (20 units/ml) (NEB) and SDS (0.25% ...
-
bioRxiv - Cell Biology 2024Quote: ... Digest were quenched by addition of EDTA to 25 mM and proteins were digested by incubation at 37°C for 40 min following addition of SDS and Proteinase K (NEB) to 0.25% and 20 units/ml respectively ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... were prepared using the NEBNext Ultra II DNA Prep Kit following the published protocol for this kit (New England Biolabs, Ipswitch, MA, USA), and quantified using an Agilent Bioanalyzer 2100 DNA 1000 kit (Agilent Technologies ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... we isolated DNA from tissue using the Qiagen DNeasy Blood and Tissue kit (Valencia, CA, USA) and created genomic libraries using the NEBNext Ultra II kit (New England BioLabs; Ipswich, MA, USA), according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... to evaluate the performance of our library preparation protocol – TM3’seq – and compare it to the performance of a commercial kit commonly used to generate RNA-seq libraries – NEBNext® Ultra™ Directional RNA kit (NEB, #E7420S). Three replicates of 200ng total RNA per tissue (blood and adipocyte ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Cloning was carried out using the Gibson Assembly® Master Mix kit and NEBuilder® HiFi DNA Assembly kit (New England Biolabs, US). Genomic DNA was prepared by the Blood & Cell Culture DNA Kit (QIAGEN ...
-
bioRxiv - Genomics 2020Quote: ... The first step involved incubation of total DNA with proteinA-MBD2-Fc mixture (NEBNext Microbiome DNA Enrichment Kit, New England BioLabs, Microbial enrichment kit, New England Biolabs, Cat No. E2612L), which binds and depletes methylated nuclear DNA fragments ...
-
bioRxiv - Microbiology 2021Quote: ... gDNA harvested with the Masterpure Complete DNA/RNA Purification Kit was bisulfite treated using the EpiMark Bisulfite Conversion kit (NEB; Ipswich, MA, USA); both per manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... rRNA was depleted from total RNA using Ribo-Zero™ rRNA removal Kit and library was made using Illumina NEBNext® Ultra™ Directional RNA Library Prep Kit (E7420L, NEB). The libraries were loaded on an Illumina HiSeq X ten instrument (Illumina) ...
-
bioRxiv - Genomics 2021Quote: ... gDNA was extracted from 1 ml of overnight culture with the kit Monarch HMW DNA Extraction kit (T#3060 New England Biolabs; Ipswich, MA, USA) following the manufacturer instructions for High Molecular Weight DNA extraction from gram-negative bacteria ...
-
bioRxiv - Genetics 2024Quote: ... The fragmented samples were purified with Expin™ PCR SV kit (GeneAll) and prepared as an NGS library with NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (NEB). The prepared samples were sequenced with MiniSeq High Output Reagent Kit (300-cycles ...
-
bioRxiv - Plant Biology 2023Quote: Libraries for each sample were prepared using the NEBNext Ultra II DNA Library Prep Kit and NEBNext Muliplex Oligos for Illumina Kits (New England Biolabs, Ipswich, Massachusetts, USA) following the NEBNext Ultra II Version 5 protocol with size selection on DNA fragments at 300-400bp range ...
-
bioRxiv - Genomics 2023Quote: ... Two libraries were prepared for Nanopore MinION sequencing using the Ligation Sequencing kit (SQK-LSK108, ONT, Oxford, UK) and NEBnext DNA Repair kit reagents (NEB, Ipswich, MA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: The novel entry modules created for this study were cloned by insertion of PCR-amplified sequences in pJet1.3 or pMiniT 2.0 following manufacturer’s instructions (CloneJET PCR Cloning Kit, Thermo Scientific; NEB® PCR Cloning Kit, NEB). BsaI recognition sites followed by module-specific overhangs were added to each primer used to amplify entry sequences ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bound antibodies were detected by incubation with anti-rabbit or anti-mouse DyLight 800-conjugated secondary antibodies (New England BioLabs). Slide images were acquired using an InnoScan 710-IR scanner (Innopsys ...
-
bioRxiv - Immunology 2021Quote: ... A mouse SUV39H1 gBlock was synthesized (IDT) and cloned into AgeI/BSpEI-digested pL-SFFV-RFP using Gibson assembly (NEB) for 1hour at 50°C ...
-
bioRxiv - Cell Biology 2022Quote: The DNA sequence coding for full length of p21 and Cyclin B1 was amplified from mouse cDNA by PCR using Phusion high-fidelity DNA Polymerase (New England BioLabs) and cloned in frame into Ch plasmid with AsiSI and NotI restriction endonucleases (New England BioLabs) ...
-
bioRxiv - Genomics 2020Quote: ... The protocol started with tissue pre-permeabilization (30 min at 33°C for mouse brain) with addition of 120μl reagent per well of exonuclease I buffer (NEB, USA). In case spleen sections were processed ...
-
bioRxiv - Neuroscience 2019Quote: ... Secondary antibodies used were: Alexa-680 goat anti-mouse IgG and Alexa-800 goat anti-rabbit IgG (New England Biolabs). For DRGN cultures ...
-
bioRxiv - Cancer Biology 2022Quote: The CAG-HA-RBMS3-PCDH cDNA expression plasmid was cloned using a cDNA template made from RNA from the lungs of a wild-type mouse using the Q5 polymerase (NEB) and restriction endonuclease cloning with the following primers ...
-
bioRxiv - Developmental Biology 2021Quote: Subcloning Both full-length and truncated (1-160) mouse Naa12 were amplified from the pMAL-c5x Naa12 plasmid using Q5 HF Master Mix (NEB), AAAACCCGGGTATGAACATCCGCCGGGCTCGGC as the forward primer ...
-
bioRxiv - Cell Biology 2019Quote: ... Standard qualitative PCRs to check for the general abundance of distinct SPIRE1 splice variants were performed employing cDNAs from mouse brain tissue and Q5 High-Fidelity DNA polymerase (New England Biolabs). Expression vectors encoding mouse SPIRE1 ...
-
bioRxiv - Neuroscience 2023Quote: ... To generate these constructs gene block fragments that codify for those sequences were produced in the Duke Transgenic Mouse Facility and cloned into the backbone using EcoRI-HF Restriction Enzyme (NEB) and In-Fusion HD Cloning Kit (Takara ...
-
bioRxiv - Immunology 2023Quote: ... The custom sgRNA vector used in this study was a hybrid AAV-SB-CRISPR plasmid for targeting primary mouse NK cells (AAV-SB100x) that was constructed by gBlock fragments (IDT) followed by Gibson Assembly (NEB). The Surf-v2 library was cloned into the AAV-SB-CRISPR vector by pooled cloning to generate the AAV-SB-Surf-v2 plasmid library.
-
bioRxiv - Molecular Biology 2023Quote: ... The corresponding regions of a partial mouse Azin1 gene were amplified from mouse tail genomic DNA by using Phusion Hot Start Flex 2X Master Mix (New England Biolabs) and the following primers ...
-
bioRxiv - Genetics 2021Quote: ... PCR amplification was performed in a 10 µl reaction volume containing 1X PCR Buffer (New England Biolabs), 10 µM dNTP and 0.05 U Taq DNA polymerase (New England Biolabs) ...
-
bioRxiv - Genomics 2022Quote: ... The mixture electroporated into 100 μL of 10-beta E.coli (NEB, C3020K, 2kV, 200 ohm, 25 μF) in order to achieve a transformation efficiency equal to 300-times the number of unique oligos sequences (target CFU ...
-
bioRxiv - Genomics 2020Quote: ... DNA libraries were amplified by PCR for 6-10 cycles with Phusion HF DNA Polymearse (NEB, M0530) using Illumina TruSeq indexing primers for multiplexing ...
-
bioRxiv - Molecular Biology 2021Quote: ... the resin was resuspended in 100 μL of NLS Buffer and 10 μL of Proteinase K (NEB) and the sample was incubated at 50°C for 30 minutes while shaking at 1200 rpm ...
-
bioRxiv - Cell Biology 2020Quote: ... Images were collected every 10 mins for up to 6 days and the timing of events (NEB, the start of cytokinetic furrow ingression and the appearance of 2 distinct cells ...
-
bioRxiv - Genetics 2020Quote: ... Sense oligos diluted to 10 μM in nuclease-free water were phosphorylated with T4 PNK (NEB #M0201) supplemented with ATP ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... 10–20% were sequentially digested with a mix of restriction enzymes according to the manufacturer’s instructions (NEB) 69 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Subsequently 5’ and 3’ termini were ligated using 10 units of T4 RNA ligase (New England Biolabs) at 37°C for 1 h ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Commercial competent cells were used for the K-12 DH10B strain (NEB® 10-beta high efficiency). Transformation of B REL606 and B REL607 was achieved via the chemical competence method ...
-
bioRxiv - Bioengineering 2020Quote: GFP1-10 was inserted into the pBAD plasmid via NEBuilder® HiFi DNA Assembly (New England Biolabs): 25 ng of the digested vector ...
-
bioRxiv - Microbiology 2020Quote: ... The supernatant was incubated with gentle shaking for 1 h with 10 mL of amylose resin (NEB) pre-equilibrated in 50 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Plant Biology 2021Quote: ... The optimal 25-μL reaction included 2.5 μL 10× ThermoPol buffer (New England Biolabs, Ipswich, Massachusetts, USA), 2.25 μL each of FIP and BIP (1.8 μM) ...
-
bioRxiv - Microbiology 2021Quote: ... 10 µg of total RNAs were subjected to RNA purification using DNase I (New England Biolabs Inc.) and the quality was checked on 2% agarose gel and verified using the Agilent Bioanalyser 2100 (Agilent technologies) ...
-
bioRxiv - Biophysics 2022Quote: ... The pooled PCR products were incubated at a 10:1 ratio with DpnI enzyme (New England Biolabs) at room temperature for 5 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... Five μg of dsRNAs were incubated with 10 units of ShortCut® RNase III (New England Biolabs) in the buffer conditions recommended by the manufacturer for 20 min at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... Parallel T7 reactions performed at the same time used 1.25 μg XbaI linearised pT7HCV(5’+)341N79wt and pT7HCV(5’+)341N79ko as templates in a 25μl final reaction volume containing 2.5μl 10 x T7 transcription buffer (NEB), 0.6μl RNaseOUT ...