Labshake search
Citations for New England Biolabs :
2551 - 2600 of 6344 citations for 6H Dibenzo b d pyran 3 pentanaminium 6a 7 10 10a tetrahydro 1 hydroxy N N N 6 6 9 hexamethyl 6aR trans 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... Second-strand DNA synthesis was done by ligating 10 µM of a blunt-end duplex comprised of a 32-bp Illumina R1-3’SpC3 and 5’-phosphorylated R1R-3’SpC3 DNA (pre-annealed by incubating at 95°C for 3 min and slowly cooling to 25°C) using a Quick ligase kit (New England Biolabs) according to manufacturer’s protocol followed by clean-up as described above ...
-
bioRxiv - Molecular Biology 2023Quote: ... The purified ribodepleted RNA samples were fragmented for 3 minutes at 94°C in Magnesium RNA Fragmentation Module (New England Biolabs) and 3’ ends were dephosphorylated with T4 polynucleotide kinase (Lucigen) ...
-
bioRxiv - Immunology 2023Quote: ... were incorporated onto the mab-oligos via a 50 μl gap-fill ligation reaction consisting of 40 U Taq ligase (New England Biolabds) 3 U T4 DNA polymerase (New England Biolabs), 100 μM dNTPs ...
-
bioRxiv - Microbiology 2023Quote: ... standard curve transcripts and viral RNA in the samples were reverse transcribed with a reverse E1 primer containing a nongenomic tag sequence74 5’-CAGACAGCACTCGTTCGTACAC-3’ through the Protoscript II First Strand cDNA Synthesis Kit (New England Biolabs). The (+ ...
-
bioRxiv - Microbiology 2023Quote: ... we transcribed T7 promoter-pre-Let7c 5’GCTCCUUGGUUUGCTUGUUGGTTGTUCUGTTUUCTCCCUGGGTGTUUCTCTUUU CCUTUCUUCCTUCTUCCTCUUCCCGGUTGCCCTATAGTGTGAGTCGTATTA 3’ and T7-promoter-pre-miR29a 5’ATAACCGATTTCAGATGGTGCTAGAAAATTATATTGACTCTGAACACCAAAAGAAA TCAGTCCCTATAGTGAGTCGTATTA3’ using the T7 high yield RNA synthesis kit (BioLabs) with α 32P UTP (Perkin Elmer ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’-TGGCCAGACGGAATCCAATG-3’ and 5’-GTGGTGGGCCACCAAGACGG-3’, and cloned into pX330-P2A-EGFP/RFP (Zhang et al, 2017) through ligation using T4 ligase (New England Biolabs). Nup96-GFP KI U2OS cells were transfected using X-tremeGENETM 9 DNA Transfection Reagent (Roche) ...
-
bioRxiv - Cell Biology 2023Quote: ... all strains were generated by the S1/2/3/4 homologous recombination PCR integration method (Janke et al., 2004) using a Q5 PCR Kit (NEB). S1-S2 primers was used to knock out endogenous proteins ...
-
bioRxiv - Cell Biology 2023Quote: ... Two gRNAs targeting UBAP2L (5’-TGGCCAGACGGAATCCAATG-3’ and 5’-GTGGTGGGCCACCAAGACGG-3’) were cloned into pX330-P2A-EGFP/RFP (Zhang et al, 2017) through ligation using T4 ligase (New England Biolabs) using the following primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... Non-IRES mRNAs were capped the 3’-O-Me-m7G(5’)ppp(5’)G anti-reverse cap analog (NEB # S1411L). IRES mRNAs were capped with the A(5’)ppp(5’)G cap analog (NEB # S1406L) ...
-
bioRxiv - Genomics 2023Quote: ... The sRNA 3’ Adaptor (5’/5rApp/ ATCTCGTATGCCGTCTTCTGCTTG /3ddC/) was ligated to the 3’-end of fragmented RNAs using truncated T4 ligase 2 (NEB), and the SRnA 5’ RNA adaptor (5’GUUCAGAGUUCUACAGUCCGACGAUC ...
-
bioRxiv - Biochemistry 2023Quote: ... 5′ phosphorylated and 3’ A-tailed by NEBNext Ultra II End Prep Enzyme Mix following the manufacturer’s instruction (New England Biolabs #E7645L). An adaptor was ligated ...
-
bioRxiv - Biochemistry 2023Quote: ... 5′ FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ1 3′) and the Luna Universal Probe one-step RT-qPCR kit (catalog no. E3006; New England Biolabs). A 20-μL RT-qPCR mixture contained 7 μL of sample ...
-
bioRxiv - Biochemistry 2023Quote: ... The array DNA was composed of a fluorescent nucleotide Alexa Fluor 647-aha-dCTP (ThermoScientific) and was generated using Klenow Fragment 3’ – 5’ exo- (NEB). Nucleosome arrays were mixed with SUV420H1 or 5μM HP1α and incubated at room temperature for 20 mins before transferring to a glass bottom 384 well plate for imaging ...
-
bioRxiv - Bioengineering 2023Quote: ... The reaction was incubated at 37 °C for 3 hours and stopped by adding 2 Units of DNase I (NEB), to digest the DNA templates and incubating at 37 °C for 15 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... and PCR amplification of the WPRE sequence and barcode with insertion into the ClaI sites proximal to the 3’ LTR by HiFi DNA Assembly (New England Biolabs). ORFs were cloned into the EcoRI site of the double-barcoded lentiviral vectors by HiFi DNA Assembly ...
-
bioRxiv - Biochemistry 2023Quote: ... The oligonucleotides were labeled at the 3’ terminus with [α-32P] dCTP (Hartmann-Analytic) by terminal transferase (New England Biolabs) prior to annealing ...
-
bioRxiv - Plant Biology 2023Quote: ... Promoters and 3’ UTRs were amplified from Col-0 genomic DNA using the primers listed in (Supp Table 3) with Q5 Hot Start High-fidelity DNA polymerase (NEB). For MBD5 and SUVH3 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and a synthetic 391 bp double-stranded DNA fragment encoding 5′-(1st gRNA/scaffold/H1 promoter/2nd gRNA)-3′ was inserted using the NEBuilder HiFi assembly system (NEB). Synthetic DNA fragments were ordered from Genewiz and sequences are listed in Table S6 ...
-
bioRxiv - Genomics 2023Quote: Each 900 ng of high molecular weight NA12878 DNA was preprocessed by first blocking at the 3’ ends with Klenow (exo-) (NEB) in the presence of 10 µM dideoxynucleotides and 1X NEBuffer 3.1 for 30m at 37°C ...
-
bioRxiv - Microbiology 2023Quote: Lysates of U2OS cells infected with wild-type HSV-2 186 at an MOI of 3 for 24 h were treated with calf intestinal alkaline phosphatase (CIP) (New England BioLabs) as described previously60.
-
bioRxiv - Microbiology 2023Quote: ... Double stranded on-bead DNA was digested with a mix of 3 blunt cutting enzymes (SspI-HF, StuI, and HincII) (NEB) to generate blunt-end DNA ...
-
bioRxiv - Genomics 2023Quote: ... The DNA with end tags was oxidized in 15 μL TET2 reaction mix (3 μL TET2 reaction buffer plus reconstituted TET2 reaction buffer supplement (NEB), 0.3 μL oxidation supplement (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5′ phosphorylated and 3’ A-tailed by NEBNext Ultra II End Prep Enzyme Mix following the manufacturer’s instruction (New England Biolabs #E7645L). An adaptor was ligated ...
-
bioRxiv - Developmental Biology 2023Quote: ... for small RNA library preparation 50 to 300 ng of total RNA was ligated with randomized 3’ adapter using T4 RNA ligase 2 truncated KQ (NEB) in 1X T4 RNA ligase reaction buffer (NEB ...
-
bioRxiv - Bioengineering 2023Quote: ... The error-prone PCR (with an error rate of 3- to 5-nucleotide mutations per kilobase) was carried out with the Taq DNA polymerase (New England BioLabs) in a reaction containing 2 µl of 10 mM primers ...
-
bioRxiv - Cell Biology 2024Quote: ... we microinjected 5 ng/μl Pmyo-3::GFP and 95 ng/μl of 2-Log DNA ladder (New England BioLabs) into the germline of GRD-3::mKate2 animals to generate transgenics expressing a muscle-specific GFP marker.
-
bioRxiv - Molecular Biology 2024Quote: ... and then ligated to the 3’ end of the cDNA by using Thermostable 5’ App DNA/RNA Ligase (New England Biolabs) for 2 h at 65°C ...
-
bioRxiv - Biophysics 2024Quote: ... A 30 nt 3′ overhang was created by treating the purified PCR product with USER enzyme mix (NEB, Cat# M5505S) for 15 min at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Immunology 2024Quote: ... A custom ribonucleoside blend was used comprising 3′-O-Me-m7G(5′)ppp(5′)G cap analog (New England Biolabs), ATP ...
-
bioRxiv - Biochemistry 2024Quote: ... cDNA was PCR amplified using the primers directed against 5′ and 3′ RNA cassettes and NEB Q5 HotStart polymerase (NEB). To introduce unique barcodes ...
-
bioRxiv - Synthetic Biology 2024Quote: ... signal was synthesized by Integrated DNA Technologies and inserted at the 3’UTR of the L1 mRNA using Hifi Assembly mix (NEB). gBlocks gene fragments containing different PBS site sequences were synthesized by Integrated DNA Technologies ...
-
bioRxiv - Immunology 2024Quote: ... the wild type and mutant pBlueScript SK(+) HEV plasmids were linearized at their 3′ end with the MluI restriction enzyme (NEB) and transcribed with the mMESSAGE mMACHINE T7 Transcription kit (Ambion #1344) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purified extension products were denatured and ligated to adaptor 2 (Ad2, Supplementary Table 3) by Instant Sticky-end Ligase Master Mix (New England Biolabs) at 4 °C overnight ...
-
bioRxiv - Molecular Biology 2024Quote: ... primer O3P (Supplementary Table 3) was attached to IP-purified DNA and was extended by NEBNext Ultra II Q5 Master Mix (New England Biolabs), followed by ExoI (New England Biolabs ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and then adenylated at the 5′ end with a 5′ DNA adenylation kit (NEB). Four random nucleotides were added in the 3′ and 5′ adapters [(5′ -rAppNNNNTGGAATTCTCGGGTGCCAAGG/amino CA linker-3′ ...
-
bioRxiv - Molecular Biology 2024Quote: ... A second adapter was then ligated to the 3’OH of the cDNAs (with NEB HC RNA Ligase in NEB ligation buffer plus 5% DMSO ...
-
bioRxiv - Molecular Biology 2024Quote: ... The oligonucleotide-based DNA substrate used for the helicase and nuclease assays was generated by labeling the BIO100C oligonucleotide (see Table S1 for oligonucleotides sequence) at the 3’ end using terminal transferase (New England Biolabs) and [α-32P]dCTP (Hartmann Analytic ...
-
bioRxiv - Developmental Biology 2024Quote: ... along with 5 ng/μl Pmyo-3::GFP and 20 ng/μl of 2-Log DNA ladder (New England BioLabs), to generate the DLS344 strain ...
-
bioRxiv - Cell Biology 2024Quote: ... and incubated with 15 µl of anti-MBP couped beads (pre-blocked for 1h in RIPA with 3 % BSA; NEB) for 2 h ...
-
bioRxiv - Cell Biology 2024Quote: ... the newly produced CENP-A-SNAP pool was labelled by exposing the mitotic cells to media containing 3 µM SNAP-Cell 647 (NEB) and 5 µM STLC (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2024Quote: Libraries of immunoprecipitated DNA were generated from 3 ng of starting DNA with the NEBNext Ultra DNA Library Prep kit for Illumina (New England Biolabs) according to manufacturer’s instructions at the CRG Genomics Core Facility (Barcelona ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and adenylated using a 5′ DNA adenylation kit at the 5′ end (NEB). To reduce ligation bias ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the radiolabeled 3’ fragment was ligated to an unlabeled 5’ fragment by splinted ligation with T4 DNA ligase (NEB) at 30°C for 2 h ...
-
bioRxiv - Genomics 2024Quote: ... The backbones for the Gibson reaction for GRB2-SH3 and PSD95-PDZ3 library assembly (aPCA plasmids) were first linearized using primers listed in Extended Data Table 3 and next treated with Dpn1 (NEB) restriction enzyme to remove the circular plasmid template ...
-
bioRxiv - Molecular Biology 2024Quote: ... The four PCR products were then assembled in a 1:1:1:1 ratio using HiFi assembly (NEB, E5520S) according to the manufacturer’s instructions to create the pLenti-STARR vector (pAS5018) ...
-
bioRxiv - Microbiology 2022Quote: The recombinant constructs (pETDuet-1-TaPHB-1 and pETDuet-1-TaPHB-1-RUVBL1 were separately transformed into E. coli Lemo21(DE3) (NEB) chemical competent cells ...
-
bioRxiv - Molecular Biology 2023Quote: ... Unincorporated ddRTP molecules were inactivated by adding 1 µL of Buffer 2 (80 mM MgCl2) and 1 µL of 1:1 rSAP (NEB):50% glycerol ...
-
bioRxiv - Genetics 2021Quote: ... including 8 bp barcode and P5 overhang (5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCATCTTTGTGGAAAGGACGAAA CACCG-3’) using the Q5 Hot Start High-Fidelity polymerase (NEB #M0494S) for 22-24 cycles ...
-
bioRxiv - Developmental Biology 2021Quote: ... The calibrated small RNA samples were ligated to an adenylated and fluorescently labeled 3’ adaptor using T4 RNA ligase 2 truncated KQ (NEB, M0373S) and were subsequently separated on a 12% polyacrylamide UREA gel ...