Labshake search
Citations for New England Biolabs :
2501 - 2550 of 5902 citations for 5 Nitro 1H benzo de isoquinoline 1 3 2H dione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... Oligonucleotides corresponding to the ‘right’ half were 5′-phosphorylated using T4 polynucleotide kinase (New England Biolabs, Ipswitch, MA). Equimolar amounts of ‘right’ strand ...
-
bioRxiv - Molecular Biology 2023Quote: ... three 25 μl PCR reactions were pooled and purified using Monarch PCR & DNA Cleanup Kit (5 μg; NEB), according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli strain MET961 was constructed by replacing the glgB gene of strain NEB 5-alpha (New England Biolabs) with the glgB::Kan-pWV01repA region from E ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 μL of the polyC-tailed products were used with 1X Taq Mg-free Buffer (New England Biolabs), 500 nM of each primer (Table 2) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1.5 μl 10 mM dNTPs, 0.5 μl 10 μM NEB Universal PCR primer, 0.5 μl 10 μM NEB index primer ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1.5 μl 10 mM dNTPs, 0.5 μl 10 μM NEB Universal PCR primer, 0.5 μl 10 μM NEB index primer ...
-
bioRxiv - Microbiology 2022Quote: ... poly(A) RNA (2-5 ng) was converted to cDNA using the Protoscript II kit (New England Biolabs) and a supplied mix of random hexamer and d(T)23VN primers ...
-
bioRxiv - Microbiology 2022Quote: ... Escherichia coli NEB® 5-alpha was used for plasmid assembly and cloning following the manufacturer’s instructions (NEB). Transformed E ...
-
bioRxiv - Molecular Biology 2023Quote: ... and decapped with 10 U of T4 PNK +/− 40 nmol of ATP and 5 U of RppH (NEB). After each step ...
-
bioRxiv - Biochemistry 2023Quote: ... dynein-bound beads were mixed with 5 µM SNAP-Cell-TMR or SNAP-AlexaFluor-647 (New England Biolabs) for 10 min at RT ...
-
bioRxiv - Cell Biology 2023Quote: ... For an R-loop negative control the preparation was treated with 5 U RNaseH (M0297S, NEB Japan, Japan) in 1× RNaseH Reaction Buffer (NEB Japan ...
-
bioRxiv - Genetics 2024Quote: ... Around 300 ng of sRNA from each sample was first treated with RNA 5′ pyrophosphohydrolase (New England Biolabs) at 37 °C for 30 min ...
-
bioRxiv - Genetics 2024Quote: ... An additional 20-minute digestion was then performed with 5 µL RNase A (NEB #T3018, 20 mg/ml). The rest of the protocol remained unchanged ...
-
bioRxiv - Genomics 2024Quote: ... 2 μL of 10% Tween-20 and 5 μL NEBNext High-fidelity 2× PCR Master Mix (NEB, M0541) was added to each well sequentially ...
-
bioRxiv - Cell Biology 2024Quote: ... dynein-bound beads were mixed with 5 μM SNAP-Cell-TMR or SNAP-AlexaFluor-647 (New England Biolabs) for 10 minutes at room temperature.
-
bioRxiv - Molecular Biology 2024Quote: ... The labeling of oligonucleotides at the 5’-end was carried out by T4 polynucleotide kinase (New England Biolabs) and [γ-32P] ATP (Hartmann Analytic) ...
-
bioRxiv - Microbiology 2024Quote: ... The plasmids were amplified using NEB 5-alpha F′Iq Competent Escherichia coli (High Efficiency) (NEB, Cat# C2992H) and isolated using the PureYield Plasmid Miniprep System (Promega ...
-
bioRxiv - Immunology 2024Quote: ... Reactions were pre-amplified for 5 cycles using NEBNext® High-Fidelity 2X PCR Master Mix (NEB, M0541L) with adapter primers ...
-
bioRxiv - Biochemistry 2024Quote: ... and then 5’ phosphates of the nucleotide sample were removed with 0.5 units of quick-CIP (NEB, #M0525) at 37 ºC for 2 hr with agitation at 800 rpm for 1 min every 10 min.
-
bioRxiv - Microbiology 2024Quote: ... followed by a 5-min extension cycle using Q5® High-Fidelity 2X Master Mix (New England Biolabs). PCR products were then purified using QIAquick® Gel Extraction Kit (Qiagen ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5% glycerol) and one time with molecular grade water followed by incubation with proteinase K (New England Biolabs) at 55 °C for 30 minutes ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5% glycerol) and one time with molecular grade water followed by incubation with proteinase K (New England Biolabs) at 55 °C for 30 minutes with constant shaking ...
-
bioRxiv - Neuroscience 2024Quote: ... Plasmids were transformed in 5’-Alpha or Stable competent bacteria (New England Biolabs, Cat C3040H and Cat C2987H), and extracted using a commercial kit (InvitrogenTM K182002) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Five micrograms of genomic DNA then were digested overnight at 37°C with 5 μL of SspI (NEB), or ScaI (NEB ...
-
bioRxiv - Synthetic Biology 2024Quote: ... An EcoRI site was generated (5’-gag to gaa) at eGFP E223 via site directed mutagenesis (NEB #E0554) with primers 5’-tcctgctggaAttcgtgaccg and 5’-ccatgtgatcgcgcttctcg ...
-
bioRxiv - Cancer Biology 2024Quote: ... The library was then amplified for 5 cycles using the NEBnext high fidelity 2X PCR Master Mix (NEB) and Nextera compatible Multiplex primers (ActiveMotif ...
-
bioRxiv - Genetics 2024Quote: ... Each 10 μL qPCR reaction contained 5 μL of NEBNext Q5 Hotstart HiFi PCR master mix (NEB # M0543L), FwdInnerSeq and RevInnerSeq at 500 nM each (final concentration ...
-
bioRxiv - Microbiology 2022Quote: ... 1 μl 40 U μl-1 RNase Inhibitor (NEB, M0314), and 1 μl T4 RNA ligase 2 (truncated K227Q ...
-
bioRxiv - Biochemistry 2020Quote: ... 1 U/μL T4 RNA ligase 1 (New England Biolabs), 1.3 U/μL Ribolock RNase inhibitor (ThermoFisher Scientific) ...
-
bioRxiv - Genomics 2021Quote: ... 1 ul i7 and 1 ul i5 (from NEB #E7600S), 8 ul 1st PCR product after SPRI beads ...
-
bioRxiv - Cancer Biology 2023Quote: ... and digested briefly (< 1 min) by 1% Proteinase K (NEB) in TE buffer at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... then 1 U of T7 endonuclease 1 (New England Biolabs) and NEB Buffer 2 were added ...
-
bioRxiv - Cell Biology 2022Quote: ... 1:100 or 1:1000 (stock 10 mg/mL, NEB) or with 1:10 Dnase I (stock 2 U/μL ...
-
bioRxiv - Biophysics 2022Quote: ... 1 µL of 0.4 µg µL-1 Lys-C (NEB) stock was added (enzyme:substrate ratio of 1:100 w/w ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 μL purified TS2126 and 1 μL PAP1 enzyme (NEB) in 7 μL Ezra buffer) ...
-
bioRxiv - Cell Biology 2020Quote: ... 1:50,000 (NEB, and anti-GST HRP conjugates ...
-
bioRxiv - Genomics 2022Quote: ... and then ‘A’ base was added to 3’ blunt ends using the A-Tailing reaction (NEBNext® UltraTM II End Repair/dA-Tailing Module, NEB, Cat. E7546). The purified A-tailed DNA was ligated with adaptors from the Ligation Sequencing Kit (SQK-LSK109 ...
-
bioRxiv - Cell Biology 2022Quote: Living ovaries were incubated at room temperature in SNAP solution containing 3 μM SNAP- Cell TMR-Star or SNAP-Cell 647SiR (New England BioLabs, S9105S and S9102S), 10% FCS and 0,2 mg/ml Insulin in Schneider’s medium ...
-
bioRxiv - Microbiology 2021Quote: ... The digested DNA (4 ml in total) was split into 4 aliquots and diluted in 8 ml ligation buffer (1X ligation buffer NEB 3 (without ATP), 1 mM ATP ...
-
bioRxiv - Zoology 2021Quote: ... a total of nine RNA libraries were prepared with 3 μg RNA using NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, USA) following manufacturer’s recommendations ...
-
bioRxiv - Plant Biology 2021Quote: ... Detection of editing in the EBE region of CsLOB1 promoter was performed by amplifying the target region (primers in Supplementary Table 3) with high fidelity DNA polymerase Q5 (New England Biolabs, Ipswich, MA, USA), followed by cloning of PCR products and sequencing.
-
bioRxiv - Molecular Biology 2023Quote: ... digoxigenin-11-ddUTP was added to the 3’ end of the digested fragments using terminal transferase enzyme (New England Biolabs, Ipswich, MA, USA).
-
bioRxiv - Microbiology 2023Quote: ... The upstream and downstream PCR products were designed to have an overlapping region of sequence to promote 3-part Gibson assembly (NEB Gibson assembly kit) and primers 5b and 4 had extensions to anneal to vector pMP62 ...
-
bioRxiv - Molecular Biology 2023Quote: All PolD mutants (Supplementary table 3) were generated using pLB047 and a Q5 Site-Directed mutagenesis kit (E0554 New England Biolabs Inc., Ipswich MA) as described by the manufacturer ...
-
bioRxiv - Molecular Biology 2024Quote: ... hereafter called Flag-SERCA2-C) were constructed from 3×Flag-SERCA2 using a Q5 Site-Directed Mutagenesis Kit (New England BioLabs, Ipswich, MA, USA). mCherry-Sec61B (Addgene ...
-
bioRxiv - Microbiology 2024Quote: ... 3 ug RNA was treated with Promega RQ1 DNase (M6101) then cleaned up with the Monarch® RNA Cleanup Kit (NEB Biolabs, T2050S) and eluted in 30 µl dH2O.
-
bioRxiv - Synthetic Biology 2023Quote: ... The inserted barcoding sequences were annealed using randomized overlapping single stranded oligonucleotides by adding 3 µl of each oligonucleotide (100 µM) to 500 µl 1x 2.1 NEB-buffer (New England Biolabs, Ipswich, MA, USA, #B6002S) followed by boiling at 100 °C for 3 minutes to finally let them associate during the cooling to room temperature ...
-
bioRxiv - Physiology 2024Quote: ... and PCR was performed with Flag F (caaggacgacgatgacaaagtc) + 3’OUTR (CAGAGCCAACAACGTGAGGT) primers using Q5® High-Fidelity DNA Polymerase (New England Biolabs, MA, USA) according to the manufacturer’s protocol ...
-
Chromosome-level assembly of Cucumis sativus cv. ‘Tokiwa’ as a reference genome of Japanese cucumberbioRxiv - Genomics 2024Quote: ... we put 3 μg of the size-selected DNA for end-repair using NEBNext FFPE DNA Repair Mix (NEW INGLAND BioLabs inc., Massachusetts, USA) and NEBNext Ultra II End Repair/dA-Tailing Module ...
-
bioRxiv - Microbiology 2024Quote: ... RNA was synthesized from a DNA template (Supplementary Table 3) using the HiScribe T7 High Yield RNA Synthesis Kit (NEB, Ipswich, MA, USA) and treated with DNase I (NEB ...