Labshake search
Citations for New England Biolabs :
2451 - 2500 of 10000+ citations for Urea Nitrogen BUN Detection Kit 10 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... 75°C) with 0.5 μg mouse Cot-1 DNA supplemented with 10 mM vanadyl ribonucleoside complex (VRC) (NEB, S1402S) and 0.2 U μL−1 RNAseOUT (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.5 ng for CTCF and 10 ng for input) were processed using NEBNext ChIP-seq library (New England Biolabs) with manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1µg purified RNA was incubated at 37°C for 30 min with 10 units of T4 PNK (NEB, M0201S) in PNK buffer containing 20 units SUPERase•In in a 25 µl reaction to remove 2′-3′-cyclic phosphates of reporter RNAs ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 µl 10 x dNTPs with dUTP instead of dTTP (2 mM each) and 1 µl T4 polymerase (NEB) were added and the mixture was incubated at 37°C in a thermal cycler for 20 min ...
-
bioRxiv - Genomics 2020Quote: ... were combined with RT primer mix [1 μl 250 ng/μl randomhexRT primer and 0.5 μl 10 mM dNTPs (NEB)] ...
-
bioRxiv - Genomics 2020Quote: ... 300 ng of purified genomic DNA was nicked with 10 U of nicking endonuclease Nt.BspQI [New England BioLabs (NEB)] at 37° for 2 hr in buffers BNG3 or BNG2 ...
-
A genome-scale CRISPR interference guide library enables comprehensive phenotypic profiling in yeastbioRxiv - Genomics 2020Quote: ... Reverse transcription was carried out using 10 ng of purified RNA in a reaction with ProtoScript II (NEB M0368S) using 2.0 pmol NI-1032 as a gene-specific primer (Table S1) ...
-
bioRxiv - Genomics 2020Quote: ... 0.5 μL of Ultra II Ligation Module Enhancer and 10 μL of Ultra II Ligation Module master mix (NEB) made up of a total of 20 μL with NFW ...
-
bioRxiv - Microbiology 2020Quote: ... IVT gRNA was produced from SFV infectious clone plasmid and treated with 10 U of DNase1 (RNase-Free; NEB) for 30 min at 37°C before purification with the RNeasy MiniElute Cleanup kit (Qiagen ...
-
bioRxiv - Microbiology 2019Quote: ... 1 pmol of DNA template was mixed with 10 pmol of oligonucleotide 9 labeled with Yakima Yellow and 1µL of HemoKlen Taq DNA Polymerase (New England Biolabs) in a 6µL reaction mixture containing 50 mM Tris-HCl pH 9.0 ...
-
bioRxiv - Microbiology 2019Quote: ... Cells were lysed in 100 µl lysis buffer (5 ml contain: 10 mM Tris-HCl pH 7.5, 4% SDS, 1 PhosSTOP tablet [Roche], a scoop of DNase I [NEB]) for 5 min at room temperature ...
-
bioRxiv - Molecular Biology 2019Quote: ... and then permeabilized in ice cold extraction buffer (CSK, 0.1% TX-100 and 10 mM Ribonucleoside Vanadyl Complex (NEB)) for 5 minutes ...
-
bioRxiv - Genomics 2020Quote: Cas9 protein and transcribed sgRNA were incubated for 10 min at room temperature in reaction buffer containing 1× NEB buffer 3.1 (NEB Biolabs) supplemented with 1 mM DTT ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Cloning was done in bacterial strain Escherichia coli NEB® 10-beta (New England Biolabs, Frankfurt a. M., Germany) grown at 37 °C in lysogeny broth [47] supplemented with 60 mg L-1 ampicillin (Applichem ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Purified first-round PCR products were combined with 10 μl NEBNext 2x High-Fidelity Master Mix (New England Biolabs), and 0.3 μM of each barcoding primer containing adapters and indexes to a total volume of 20 μl ...
-
bioRxiv - Bioengineering 2020Quote: ... Cells were then resupended in 100 µL Ligase Solution (50mM HEPES pH 7.5, 10 mM MgCl2, 1mM rATP (New England Biolabs), 9.5 nM Connector oligomer (TTTCACGACACGACACGATTTAGGTC ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 5’ end of the digested RNA is then labelled with 10 U T4 PNK (New England Biolabs M0201) and 10 µCi [γ-32P]ATP (Perkin Elmer BLU002Z250UC ...
-
bioRxiv - Cell Biology 2021Quote: ... The Pre-hybridization Buffer was replaced with 250 μl of Hybridization Buffer (2x SSC, 10% deionized formamide, 0.1% Tween-20, 2 mM vanadyl ribonucleoside complex (New England Biolabs), 100 μg/mL salmon sperm DNA (Invitrogen) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 96-well plates were centrifuged again at 3000 x g for 10 min and 1 µL of the supernatant was used in 12.5 µL PCR reactions with Taq polymerase (NEB) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... The supernatant was passed three times over a column of 10 ml of amylose resin (New England Biolabs, E8031L). The column was washed with MBP wash buffer (50 mM Tris-HCl ...
-
bioRxiv - Molecular Biology 2021Quote: ... The pellet was resuspended in 18.5 μL T4 DNA Ligase Reaction Buffer with 5 μL of 10 μM annealed Broken end linker and 1.5 μL T4 DNA Ligase (#M0202S, New England Biolabs). The reaction was incubated 18-20 h at 16°C with constant mixing ...
-
bioRxiv - Biophysics 2020Quote: ... and loaded denatured (70 °C, 10 minutes) samples alongside an RNA ladder (2-4 μL, ssRNA ladder, N0362S, NEB). The resulting gels were stained with ethidium bromide for 30 minutes (0.5 μg/mL ddH20 ...
-
bioRxiv - Genomics 2021Quote: ... 10°C hold in one cycle) by adding 25 µl of 2X PCR master mix (New England Biolabs, M0541S) and 0.8 µl of Ad 2.X reverse primer ...
-
bioRxiv - Neuroscience 2022Quote: ... we added 1μL unique barcoded N5&N7 (0.5 µM final concentration) and 10 μL NEBNext High-Fidelity 2x PCR Master Mix (NEB). PCR cycling conditions were as follow ...
-
bioRxiv - Biochemistry 2022Quote: ... 1× CutSmart buffer (50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate,100 μg/mL BSA, pH 7.9, NEB), 20 U RiboLock ...
-
bioRxiv - Molecular Biology 2022Quote: ... The membrane was cut into pieces and PK buffer (100 mM Tris pH 7.4, 50 mM NaCl, 10 mM EDTA) was added together with Proteinase K (NEB). After 90 min of incubation at 37°C ...
-
bioRxiv - Bioengineering 2022Quote: ... synthetic dsDNA target oligos were prepared by hybridizing 10 μM of ssDNA template with 50 μM of complementary ssDNA in 1x NEBuffer 2.1 (NEB), to provide a solution with an effective dsDNA concentration of 10 μM ...
-
bioRxiv - Developmental Biology 2022Quote: ... dissected wing imaginal discs were incubated for 10 min at 25°C with SNAP-Surface Alexa Fluor 546 (3.3 μM, from NEB), rinsed and incubated for 15 min with SNAP-Surface Block at 13 μM before fixation and immunolabeling ...
-
bioRxiv - Genomics 2021Quote: ... We amplified libraries by adding 10 ul DNA to 25 ul NEBNext HiFi 2x PCR mix (New England Biolabs) and 2.5 ul of a 25 uM solution of each of the Ad1 and Ad2 primers ...
-
bioRxiv - Evolutionary Biology 2021Quote: DNA was isolated from single fins by placing them in lysis buffer (10mM Tris pH 8, 100mM NaCl, 10 mM EDTA, 0.5% SDS) with Proteinase K (333µg/mL, NEB P8107S) at 55°C for between four hours and overnight ...
-
bioRxiv - Molecular Biology 2019Quote: ... DNase treatment of indicated samples was carried out by incubation of each sample with 10 μl of DNaseI (NEB), 5 μl of Benzonase Nuclease (Novagen ...
-
bioRxiv - Genetics 2020Quote: ... 10 μl of 20 ng/ul DNA per individual was fragmented using the high-fidelity enzymes NsiI / MspI (NEB) combined in a double digest ...
-
bioRxiv - Microbiology 2021Quote: ... 40 μL of 10 μM FISH probes in hybridization buffer (10% dextran sulfate [Sigma], 2mM vanadyl ribonucleoside complexes [#514025, NEB], 0.02% RNAse-free BSA [NEB] ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The total volume reaction was 25 μl with the following composition: 5 μL 10× buffer at 1.0 mM (New England BioLabs), 0.1 mM each dNTP ...
-
bioRxiv - Biochemistry 2022Quote: ... The N-linked glycans and the CBP tag were cleaved by endoglycosidase H (Endo H, ∼0.2 mg per 10–15 mg purified protein, New England Biolabs) and HRV-3C protease (∼2 mg per 10–15 mg purified proteins ...
-
bioRxiv - Genetics 2019Quote: ... 10 pmoles of forward and universal reverse primers were annealed and extended with Q5 high-fidelity DNA polymerase (NEB) according to the recommended conditions and with the following program ...
-
bioRxiv - Biochemistry 2020Quote: ... 150 mM NaCl) and incubated for 10 min at 37 °C with 2.000 units/mL of DNase I (New England BioLabs). Half of the resulting sample was incubated with 10 µg/mL of PK (Sigma Aldrich ...
-
bioRxiv - Molecular Biology 2019Quote: ... followed by 10 µl of 10X NEB2 buffer and 15 µl of HindIII (New England Biolabs, 20 U/µl) to digest at 37°C for 2 hr ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The solution was then equilibrated to 42°C for 10 min before adding 2 μL of β-agarase (NEB). Finally ...
-
bioRxiv - Pathology 2019Quote: ... by adding a mixture of 10 µl DNase I and 190 µl DNase I Reaction Buffer (New England Biolabs) to the priming port and incubated for 30 minutes at room temperature ...
-
bioRxiv - Molecular Biology 2020Quote: ... in a total volume of 20 µL containing 10 U of T4 RNA Ligase 1 (NEB, cat n° M0204L), 1X T4 RNA ligase buffer ...
-
bioRxiv - Synthetic Biology 2021Quote: ... the IVT template RNA (0.01– 0.05 A260 units) was digested into nucleosides using 10 µg/ml nuclease P1 (New England Biolabs, M0660S), and 0.5 U/ml Bacterial Alkaline phosphatase (Takara 2120A ...
-
bioRxiv - Molecular Biology 2021Quote: ... The pellet was resuspended in 88 μL of NEBuffer 2.1 with 10 μL dNTP (1mM, #N0446S, New England Biolabs) and 2 μL T4 DNA Polymerase (#M0203S ...
-
bioRxiv - Bioengineering 2021Quote: ... 50 ng input genomic DNA was first linearly pre-amplified with 10 nM final concentration 5p-CCR5_UMI primer using the Q5 High-Fidelity DNA Polymerase (New England Biolabs): (98 °C ...
-
bioRxiv - Genetics 2019Quote: ... followed by 10 μl of 10X NEB2 buffer and 15 μl of HindIII (New England Biolabs, 20 U/μl) to digest at 37°C for 2 hr ...
-
bioRxiv - Molecular Biology 2020Quote: ... cDNA was synthesized from total RNA of 10-d-old seedlings using M-MuLV reverse transcriptase (New England Biolabs); each gene was amplified using specific primers (see Supplemental Table 2 ...
-
bioRxiv - Genomics 2021Quote: ... Ligation was done overnight at 16°C also rotating at 900rpm for 10 seconds every 5 minutes by adding 120μl of 10X ligation buffer (NEB), 664μl water ...
-
bioRxiv - Biochemistry 2021Quote: ... The mixture was incubated at room temperature for 10 min followed by transformation into 5-alpha competent cells (NEB). The E ...
-
bioRxiv - Developmental Biology 2022Quote: ... Ligation was done overnight at 16°C also rotating at 900rpm for 10 seconds every 5 minutes by adding 120µl of 10X ligation buffer (NEB), 664µl water ...
-
bioRxiv - Microbiology 2021Quote: ... Chromosomal DNA (1 µg) was digested with 10 units (1 µl) of restriction enzyme AciI (New England Biolabs (NEB)) for one hour at 37°C ...