Labshake search
Citations for New England Biolabs :
2451 - 2500 of 6874 citations for 7 6 7 dimethoxy 3 4 dihydroisoquinolin 1 yl 2 methyl 3 2 methylphenyl quinazolin 4 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... and then digested by 2 U of T7 endonuclease I (T7E1, New England BioLabs) at 37 °C for 15 min ...
-
bioRxiv - Cell Biology 2020Quote: The pIGLR-2∷mCherry construct was generated with a Gibson assembly cloning kit (NEB) with the following four fragments ...
-
bioRxiv - Biochemistry 2020Quote: ... the supernatant was collected and passed through a 2 mL Amylose resin (NEB E8021S) pre-equilibrated with lysis buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... The reverse transcriptase linker was then ligated with T4 RNA Ligase 2 truncated (NEB) and reverse transcribed using M-MLV RNase H minus (Promega) ...
-
bioRxiv - Biophysics 2021Quote: ... was generated by subcloning Mdn1 aa4381-4717 into pSNAP-tag(T7)-2 (NEB N9181S) downstream of the SNAP tag ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 and cloned into pET28a using T4 DNA ligase (New England Biolabs GmbH, Germany). The gene encoding ribose-phosphate pyrophosphokinase (RPPK ...
-
bioRxiv - Bioengineering 2022Quote: ... Samples requiring dephosphorylation were treated with 2 U/μL λPP (New England Biolabs, # P0753) for 3 h at 30°C and then washed with PBSCM ...
-
bioRxiv - Cancer Biology 2022Quote: ... DNase I (2 µL, 2,000 U/ml, RNase-free, New England Biolabs, Ipswich, MA), 10× DNase buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... and inserted into the pGLuc Mini-TK 2 Gaussia luciferase enhancer reporter plasmid (NEB) via KpnI/SacI restriction sites ...
-
bioRxiv - Neuroscience 2022Quote: ... and nuclei were resuspended in 2 mL 1x NEBuffer 3.1 (New England Biolabs; B7203S) + 20uL NxGen RNase Inhibitor.
-
bioRxiv - Molecular Biology 2022Quote: ... were ligated to dephosphorylated RNAs using T4 truncated RNA ligase 2 (K227Q) (NEB, #M0351L). Unligated linkers were depleted by using 5 U per sample of 5’ deadenylase (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... Secondary amplification reactions were performed using NEBNext high-fidelity 2 PCR master mix (NEB) in 50 μl reactions (26 μl of 2X mix ...
-
bioRxiv - Microbiology 2022Quote: ... The resulting nucleic acids were treated with 2 U DNase I (New England Biolabs), 10 U S1 nuclease (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2024Quote: ... 20 µL of reactions were treated with 2 µL DNase I (NEB, Cat # M0303S) in a total volume of 100 µL at 37°C for ∼ 20 min before further analysis and treatment.
-
bioRxiv - Immunology 2023Quote: ... and 2 µL of home-made Gibson mix (T5 exonuclease (0.2U; New England Biolabs), Phusion polymerase (12.5U ...
-
bioRxiv - Cell Biology 2024Quote: ... all kinases were tested for activity using 2 µg each of histone H1 (NEB) or Myelin Basic Protein (MBP ...
-
bioRxiv - Developmental Biology 2024Quote: ... R0148S)2 or the wild-type allele was digested with HphI (New England Biolabs, R0158S) for 1 hour ...
-
bioRxiv - Genomics 2024Quote: ... and mixed with an equal volume of 2 x RNA loading dye (NEB, B0363S). 25 μl of the mixture was loaded on a 10% TBE-Urea gel (Bio-Rad ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 μL of a mix containing 5 U of T4 RNA Ligase 2 (NEB), 1 mM ATP ...
-
bioRxiv - Molecular Biology 2023Quote: ... The reaction with T4 RNA ligase 2 was performed in 1x T4 Rnl2 (NEB) supplemented with PEG 8000 (10% ...
-
bioRxiv - Microbiology 2023Quote: ... the RNA samples were treated using 2 units of DNase I (New England Biolabs) according to the manufacturer’s instructions to eliminate residual gDNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... or NEBNext Ultra II DNA Library Prep Kit for Illumina (replicate 2: NEB, E7645S), according to the manufacturers’ protocols ...
-
bioRxiv - Plant Biology 2023Quote: ... 2 μL of 10x T4 DNA Ligase Buffer with 10 mM ATP (NEB, B0202S), 1 μL of PaqCI/AarI activator (5 pmol ...
-
bioRxiv - Physiology 2023Quote: ... for every 2 µg of fusion protein in 1X TEV buffer (Catalog P8112S, NEB) for 16h at 30°C.
-
bioRxiv - Cell Biology 2023Quote: ... The eluted sample was incubated with 2 ml amylose resin (New England Biolabs, E8021L) for 1 h at 4°C ...
-
bioRxiv - Bioengineering 2022Quote: ... 10 μL PCR reactions were set-up using 2 μL 5x HF Buffer (NEB), 0.5 μL 10 mM dNTPs (NEB) ...
-
bioRxiv - Biophysics 2023Quote: ... 2 pmol were digested to single nucleosides using the Nucleoside Digestion Mix (NEB # M0649), and the ratio of Ψ s versus uridines was determined via tandem quadrupole mass spectrometry (Supplementary Figure S2a).
-
bioRxiv - Microbiology 2023Quote: ... 20-μL reactions contained 2 μM enzyme and 250 μM NTPs (New England BioLabs) in reaction buffer with 50 mM Tris-HCl (pH 7.5) ...
-
bioRxiv - Developmental Biology 2023Quote: ... On-Bead 5’ Decapping reaction was done using NEBuffer 2 buffer (NEB, B7002S ®). Off-Bead Reverse Transcription followed the instructions in SuperScript ® IV Reverse transcriptase kit ...
-
bioRxiv - Microbiology 2023Quote: ... The annealed constructs were ligated using 2 µL T4 RNA ligase2 (NEB, 10U/µL), 3 µL 0.1% BSA (Ambion) ...
-
bioRxiv - Molecular Biology 2023Quote: ... two pairs of oligonucleotides (Suppl. Table 2) were phosphorylated and ligated into BsbI (NEB) digested pDG459 plasmid ...
-
bioRxiv - Molecular Biology 2023Quote: ... a pair of oligonucleotides (Suppl. Table 2) was phosphorylated and ligated into BsbI (NEB) digested pX459 and pX458 plasmids ...
-
bioRxiv - Biophysics 2023Quote: ... 11 uL Exonuclease I Buffer and 2 uL Exonuclease I (New England Biolabs; M0293S) was added following reverse transcription and incubated at 37 °C for 15 min ...
-
bioRxiv - Genomics 2023Quote: ... Forked adapters (Supplementary Table S7) were annealed in NEBuffer 2 1X (NEB cat. B7002S) to a final concentration of 20 µM in a thermal cycler set to heat at 98°C and gradually cool down to 4°C with a 1°C per 20 sec gradient.
-
bioRxiv - Immunology 2024Quote: ... washed in 10 mL RPMI+10% FBS + 2 µl RNase-free DNase I (NEB), and stained with LIVE/DEAD Aqua for 15 minutes at room temperature ...
-
bioRxiv - Immunology 2024Quote: ... washed in 10 mL RPMI+10% FBS + 2 µl RNase-free DNase I (NEB), and placed in single-cell suspension in 1 mL RPMI+10% FBS ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 μM of dsDNA was incubated with CpG methyltransferase (M. SssI, New England Biolabs) in the presence of 200 μM of S-adenosylmethionine ...
-
bioRxiv - Genetics 2024Quote: ... the DNA-bound beads were digested with 2 μl BpmI (NEB, catalog number R0565L) for 30 min at 37 °C ...
-
bioRxiv - Developmental Biology 2024Quote: ... Libraries were generated via PCR amplification using NEBNext HighFidelity 2× PCR Master Mix (NEB). The resultant libraries were purified again using the MinElute PCR Purification Kit (Qiagen) ...
-
bioRxiv - Genomics 2024Quote: ... 0.4 µL RNase Inhibitor and 2 µL Induro RT (200 U/µL; NEB M0681S) were incubated for 15 minutes at 60°C ...
-
bioRxiv - Neuroscience 2022Quote: ... One-step RT-qPCR was performed using the Luna universal One-Step RT-qPCR kit (New England BioLabs) in a total volume of 20 µl and a template concentration of 50 ng/µl according to the manufacturer’s recommendations ...
-
bioRxiv - Neuroscience 2024Quote: One-step RT-qPCR was performed using the Luna universal One-Step RT-qPCR kit (New England Biolabs) in a total volume of 10 µl and a template concentration of 50 ng/µl according to manufacturer’s recommendation ...
-
bioRxiv - Developmental Biology 2023Quote: ... NEB One Taq RT-PCR kit (One Taq® RT-PCR Kit, New England Biolabs INC, Frankfurt, Germany) was used for cDNA synthesis ...
-
bioRxiv - Genomics 2021Quote: ... and washed 3 times with ice-cold 10 mM Ribonucleoside Vanadyl Complex (RVC) (New England BioLabs, cat.no. S1402S, Ipswich, Mass, USA) in buffer A (10 mM NaCl ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 10 µl was mixed with 40 µL of 1x NEBuffer 3 supplemented with 10 mM MgCl2 and 5 units of Mbo I (New England BioLabs #R0147L). This reaction was incubated for 1 hour at 37°C ...
-
bioRxiv - Genetics 2021Quote: ... including 8 bp barcode and P5 overhang (5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCATCTTTGTGGAAAGGACGAAA CACCG-3’) using the Q5 Hot Start High-Fidelity polymerase (NEB #M0494S) for 22-24 cycles ...
-
bioRxiv - Molecular Biology 2021Quote: Telomeric duplex DNA 5′-GGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGCCCCTC-3′ and antisense (5′-GAGGGGCCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCC-3′ was end-labeled with [γ-32P]ATP (Amersham Biosciences) and T4-polynucleotide kinase (New England BioLabs) and purified from free nucleotides through G25 spin columns (GE Healthcare) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3’UTRs were combined to the TagRFP-T CDS using the Gibson assembly Master Mix (Cat#E2611, New England BioLabs Inc). The resulting fragment was then amplified via PCR and digested prior ligation into a vector containing only Hofstenia promoter region ...
-
bioRxiv - Cell Biology 2022Quote: ... The mixture was incubated for 3 days at 37 °C in the dark for conjugation and purified for 3 rounds using Monarch® PCR & DNA Cleanup Kit (5 μg) (Cat# T1030S, NEB) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... The plasmid was linearized with SacI or XhoI (for transcription from T7 or SP6 promoter respectively) and 3’UTR fragment was transcribed in vitro using SP6 or T7 polymerases (New England Biolabs, UK) and the DIG RNA labelling Mix (Roche) ...