Labshake search
Citations for New England Biolabs :
201 - 250 of 10000+ citations for Mouse Vacuole Membrane Protein 1 VMP1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... 1:8 dilution Cas9 protein (New England Biolabs, cat. M0386M; diluted in buffer B, New England Biolabs, cat. B802S) and 1:40 dilution of phenol red (Sigma Aldrich) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1 μg of each sgRNA and 60 pmol Cas9-NLS protein (EnGen® Spy Cas9 NLS, NEB, M0646 M) with the Lonza 4D X-unit ...
-
bioRxiv - Genetics 2021Quote: ... Five µl of the hybridization product was combined with 1 µl of 20 µM Cas9 protein (New England Biolabs) at room temperaturefor 5 minutes ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1 x 106 PDCL-1108 cells were electroporated with 10 μg spCas9-NLS protein (New England Biolabs, Ipswich, MA), 4 μg guide RNA and 200 pmol ssODN using the Amaxa Nucleofector II (Lonza ...
-
bioRxiv - Biochemistry 2023Quote: Trx-linker concatemers (1 mg/mL) were incubated with 50,000 units of the catalytic subunit of cAMP-dependent protein kinase (PKA) (NEB)—which recognizes the RRAS motif within the central linker of the Trx-linker nonamer—in protein kinase buffer (50 mM Tris HCl ...
-
bioRxiv - Developmental Biology 2024Quote: ... A cocktail of guide RNAs for each target (1 μL each) was pre-incubated with Cas9 protein (NEB #M0646M) and 0.68uL KCl (as described in (100)) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 100 - 400 ng of PCR fragments were used as template DNA to synthesize analytic amounts of DNA deaminases using PURExpress In Vitro Protein Synthesis kit (NEB, Ipswich, MA) following manufacturer’s recommendations.
-
bioRxiv - Plant Biology 2021Quote: ... The immunoprecipitated protein was incubated with λ protein phosphatase using manufacturer’s protocol (Cat. # P0753S, NEB). The treated samples were resolved on SDS-PAGE and western blotting performed using OsFD7 antibody.
-
bioRxiv - Plant Biology 2022Quote: ... The protein extracts were incubated with Lambda Protein Phosphatase (λ-PPase) (NEB, Cat. No. P0753S) at 30 □ for 30 min and subsequently added 5×SDS sample buffer incubated at 95 □ for 5 min ...
-
bioRxiv - Developmental Biology 2020Quote: ... 75°C) with 0.5 μg mouse Cot-1 DNA supplemented with 10 mM vanadyl ribonucleoside complex (VRC) (NEB, S1402S) and 0.2 U μL−1 RNAseOUT (Invitrogen ...
-
bioRxiv - Biochemistry 2023Quote: ... The coding sequence of mouse PADI4 (residues 1-666) was amplified and cloned into pET28a vector using NdelI (NEB) and XhoI (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: DNAse-treated RNA with high RIN value was used to deplete ribosomal RNA using NEBNext® rRNA Depletion Kit (Human/Mouse/Rat) (NEB #E6350) as per manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... sgRNA target site mutation in mouse Thap1 cDNA was generated by Q5 Site-Directed Mutagenesis Kit (NEB, see Table S3 for primers). WT or Thap1-/-Brca1Δ11 MEFs (1 × 106 ...
-
bioRxiv - Microbiology 2021Quote: ... ribosomal RNA depletion was carried on the extracted RNA using Nebnext rRNA depletion kit (Human/mouse/rat) (New England BioLabs. In, USA). Subsequently ...
-
bioRxiv - Microbiology 2023Quote: ... RNA-seq libraries were prepared from RNA samples (150ng) using the NEBNext rRNA Depletion Kit v2 (Human/Mouse/Rat) (NEB Cat# E7405) in conjunction with NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB Cat# E7765) ...
-
bioRxiv - Biochemistry 2023Quote: ... An mRNA transcript library for Illumina sequencing was created using the NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (New England Biolabs, Ipswich, MA). A NextSeq 500 sequencer (Illumina ...
-
bioRxiv - Biochemistry 2021Quote: ... mouse anti-MBP monoclonal (NEB), anti-mouse-HRP (Dianova) ...
-
bioRxiv - Immunology 2023Quote: All PD-1 mutants were generated using Q5 site-directed mutagenesis kit (NEB) following the manufacture’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA was first circularized by a T4 RNA Ligase 1 Kit (M0204. NEB) and then purified by TRIzol reagent followed by isopropanol precipitation ...
-
bioRxiv - Biochemistry 2021Quote: ... and one plasmid was randomly selected from those plasmids and used for expression with a PURE system (PURExpress In Vitro Protein Synthesis Kit, New England BioLabs, Ipswich, MA, USA).
-
bioRxiv - Neuroscience 2023Quote: ... Samples were diluted to 1.0 mg/mL protein using homogenization buffer and incubated with 20 U/μL lambda phosphatase in MnCl2 and enzyme buffer as supplied with the lambda protein phosphatase kit (New England Biolabs, Evry-Courcouronnes, France) for 3 h at 30 °C ...
-
bioRxiv - Microbiology 2021Quote: ... which were incubated with 1 μg/ml full-length S protein with His tag that had been pretreated with or without FXa (P8010L, NEB) for 2 hours at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... Dephosphorylated RNA-protein complexes were then rinsed once with NT2 buffer and 3’-end ligated with T4 RNA Ligase 1 (NEB) overnight in an Eppendorf Thermomixer at 16°C ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... we added 150 – 1000 ng of DNA to 1 μl of prepared MBD2-Fc/protein A beads (New England Biolabs), then washed and eluted the DNA as described by Chiou and Bergey (2018) ...
-
bioRxiv - Genomics 2021Quote: ... equal amount of naked DNA and DNA bound by Reb1 protein (~ 5pmol) were incubated with AAG (10 units) and APE1 (1 unit) (New England Biolabs) in a 20 μL reaction containing 1X Thermopol buffer (20mM Tris HCl pH 8.8 ...
-
bioRxiv - Genomics 2022Quote: ... for 2 hours and then crosslinked with p19 siRNA binding protein (1 μg/ml in depc-PBS; New England Biolabs) or anti-N6-methyladenosine (m6A ...
-
bioRxiv - Molecular Biology 2023Quote: ... TIS11B protein-RNA complexes were immunoprecipitated from 1 ml of crosslinked lysate and washed with high salt and PNK buffer (NEB). RNA was repaired by 3′ dephosphorylation and ligated to L3-IR adaptor on beads ...
-
bioRxiv - Biochemistry 2023Quote: ... Cleared lysate containing the nucleosomes was incubated with purified MBP-tag or MBP-FoxP3ΔN protein (1uM) for 1 hour at 4℃ and then subjected to MBP pulldown using Amylose Resin (New England Biolabs). After proteinase K (New England Biolabs ...
-
bioRxiv - Cell Biology 2023Quote: ... the reaction was stopped with a final concentration of 50 mM EDTA and the proteins were removed by treatment with proteinase K (1/100 of the volume – NEB) and SDS (0.1% ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was PCR amplified (primers hFUR Exon 1-3 PCR For and hFUR Exon 1-3 PCR Rev) and purified (Monarch PCR & DNA cleanup kit, NEB). The resulting PCR product was sequenced using the hFur Exon 1 Seq primer.
-
bioRxiv - Microbiology 2023Quote: ... RNA was extracted using phenol-chloroform and subjected to ribosomal RNA removal using a NEBNext® rRNA Depletion Kit (Human/Mouse/Rat) (NEB, Ipswich, MA). A RNAseq library was prepared by using a NEBNext® Ultra directional RNA library prep kit (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... 1200 units λ-protein phosphatase (NEB) were diluted into phosphatase assay buffer without cell lysate ...
-
bioRxiv - Microbiology 2021Quote: ... Stained and unstained protein ladders (NEB; #P7719S and #P7717S ...
-
bioRxiv - Molecular Biology 2019Quote: ... 200 units λ protein phosphatase (NEB) was added to 10 μL of the suspension ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1uL of lambda protein phosphatase (NEB) was added to samples ...
-
bioRxiv - Bioengineering 2021Quote: ... 90 nM of SpCas9 protein (NEB), NEB buffer 3.1 (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... and Cas9 protein (NEB - 0.3 μM). This was incubated at 37°C for 10 minutes before microinjection ...
-
bioRxiv - Genetics 2022Quote: ... and Cas9 protein (NEB - 0.3 μM). This was incubated at 37°C for 10 minutes before microinjection ...
-
bioRxiv - Microbiology 2022Quote: ... Color Prestained Protein Standard (NEB, P7719) or Precision Plus Protein All Blue Prestained Protein Standards (BioRad ...
-
bioRxiv - Microbiology 2020Quote: ... proteins were deglycosylated by PNGaseF (NEB) prior to gel electrophoresis ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Cas9 protein was purchased from NEB EnGen Cas9 NLS ...
-
bioRxiv - Microbiology 2023Quote: Protein expression vector pMAL-c5Xa (NEB) was used as the backbone for constructing the mCherry reporter ...
-
bioRxiv - Biochemistry 2022Quote: ... Protein markers (New England Biolabs, #P7719S) were used for molecular mass determination.
-
bioRxiv - Microbiology 2023Quote: ... proteins were deglycosylated by PNGaseF (NEB) prior to gel electrophoresis to facilitate analysis.
-
bioRxiv - Cell Biology 2023Quote: ... and Protein Kinase A (NEB, P6000S) were purchased from New England Biolabs ...
-
bioRxiv - Bioengineering 2024Quote: ... including protein disulfide bond enhancer (NEB) and GamS (NEB) ...
-
bioRxiv - Genomics 2024Quote: ... 90 nM of SpCas9 protein (NEB), NEB buffer 3.1 (NEB ...
-
bioRxiv - Developmental Biology 2021Quote: Subcloning Both full-length and truncated (1-160) mouse Naa12 were amplified from the pMAL-c5x Naa12 plasmid using Q5 HF Master Mix (NEB), AAAACCCGGGTATGAACATCCGCCGGGCTCGGC as the forward primer ...
-
bioRxiv - Molecular Biology 2021Quote: ... original numbering with signal sequence = 20–559) were subcloned into the manufacturer-supplied plasmid from the PURExpress® In Vitro Protein Synthesis Kit (New England Biolabs, Ipswich, MA, USA) using the Gibson assembly method with synthetic E ...
-
bioRxiv - Biochemistry 2019Quote: ... Immunoblotting was performed using HRP-conjugated anti-maltose binding protein (MBP) monoclonal antibody at 1:10000 dilution (New England Biolabs, #E8038) to verify equal expression levels of each construct.