Labshake search
Citations for New England Biolabs :
201 - 250 of 482 citations for Mouse Anti CMV Glycoprotein B Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Systematic Analysis of Lysine Succinylation in Vero cells infected with Small Ruminant MorbillivirusbioRxiv - Genomics 2021Quote: ... 72 h post infection (hpi) and analysed by western blotting and pan anti-succinyllysine antibody (PTM-419, PTM Biolabs, Hangzhou, China), and non-inoculated cells served as control group ...
-
bioRxiv - Microbiology 2024Quote: ... The membrane was incubated for 1 hour in the presence of an anti-SNAP-tag primary antibody (New England Biolabs #P9310S) diluted at 1:2000 in PBS + tween-20 0.1% ...
-
bioRxiv - Neuroscience 2022Quote: ... Ribo-Zero Gold (Human/Mouse/Rat) Kit (Illumina; NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350, NEB); NEXTflex™ Small RNA Sequencing Kit v3 (PerkinElmer ...
-
bioRxiv - Biochemistry 2020Quote: GQES7-a and GQES7-b were synthesized in vitro by transcription (HiScribe™ T7 High Yield RNA Synthesis Kit; New England Biolabs). GQes3 and mutes3 ...
-
bioRxiv - Genomics 2021Quote: ... TF motif libraries in pGL4.10-Sasaki-SS (a) and pCpG-free-EF1α-SS (b) vectors were amplified using standard Illumina Universal and index primers (NEB #E7335S) and sequenced using standard Illumina chemistry ...
-
bioRxiv - Synthetic Biology 2023Quote: ... (fhuA2 [lon] ompT gal (lambda DE3) [dcm] ΔhsdSlambda DE3 = lambda sBamHIo ΔEcoRI-B int::(lacI::PlacUV5::T7 gene1) i21 Δnin5) (New England Biolabs, C2527I) were used ...
-
bioRxiv - Biochemistry 2023Quote: ... XBP1 Part A and Part B were produced by adding a T7 promoter sequence (TAATACGACTCACTATAGGG) and using the HiScribe T7 RNA Synthesis Kit (NEB E2040S). Template DNA was digested by adding DNase I and incubation for 15 min at 37 °C ...
-
bioRxiv - Biochemistry 2022Quote: ... MBP (mouse, 1:30,000, New England Biolabs), FLAG (mouse ...
-
bioRxiv - Plant Biology 2022Quote: ... The membranes were washed with TBS and incubated with a horseradish peroxidase (HRP)-conjugated anti-MBP monoclonal antibody (New England Biolabs; 1:5000).
-
bioRxiv - Cell Biology 2022Quote: ... SNAP-GLP-1R and SNAP-GIPR were detected with an anti-SNAP-tag rabbit polyclonal antibody (P9310S, New England Biolabs, 1/1,000) followed by goat anti-rabbit HRP secondary (ab6271 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Membranes were incubated overnight at 4 °C with the appropriate antibody: rabbit monoclonal anti-GSK3β (1:1,000; product # 9315, Cell Signalling Technology, New England BioLabs, Whitby, Ontario, Canada), rabbit polyclonal anti-p[Ser9]GSK3β (1:500 ...
-
bioRxiv - Plant Biology 2021Quote: ... Immunoprecipitation experiments were performed with 15 μL of Pan anti-glycine lysine antibody conjugated to agarose beads (PTM Biolabs, Chicago, IL, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 0.1% Tween) with 3% BSA and then incubating the strips in 1:2000 dilution of monoclonal anti-MPB-HRP antibody (NEB, Inc, USA) in a blocking buffer for 1 h at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... Protein samples were resolved on an 12% SDS-polyacrylamide gel electrophoresis and transferred to polyvinylidene fluoride membrane for detection with the following antibodies: anti-Glucocorticoid Receptor D6H2L (1:1000 dilution, Cell Signaling, New England BioLabs #12041), anti-PAX7c (1:500 dilution ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The expression of each engineered component was validated pre- and post-sort by staining Jurkat cells with an anti-Myc antibody (#2233S, NEB, MA, USA), followed by performing flow cytometry on a FACSCanto (BD Biosciences) ...
-
bioRxiv - Genetics 2024Quote: ... The B splice form (Spc105RB) was generated using site directed mutagenesis to delete the first intron from the A form (NEB BaseChanger Kit). All mutants were generated using site specific mutagenesis of the A- or B-form Spc105R coding region in the pENTR4 vector ...
-
bioRxiv - Molecular Biology 2023Quote: ... Protein blots were incubated with primary antibodies overnight at 4°C using the above-mentioned antibodies and the Gaussia Rabbit Polyclonal Antibody (E8023S, New England BioLabs), the Influenza A NS1 Mouse Monoclonal Antibody (sc-130568 ...
-
bioRxiv - Biochemistry 2020Quote: ... Histone extracts were then resolved on a 15% polyacrylamide gel and Kac levels were determined with Western blot using anti-acetyllysine antibody (PTM Biolabs, Cat# PTM-101), with anti-Knbu/Kibu as the positive control using anti-butyryllysine antibody (PTM Biolabs ...
-
bioRxiv - Biochemistry 2021Quote: ... 1000 base pairs upstream and downstream from the C-terminus of clpP1 were amplified by PCR using the A–B and C–D primer pairs from Table 2 (Phusion polymerase, GC buffer, New England Biolabs, Ipswich, United States). For clpP2 ...
-
bioRxiv - Plant Biology 2022Quote: ... The precipitates and one-fifth of the supernatant were boiled in SDS loading buffer and subjected to western blot analysis using an anti-MBP monoclonal antibody (New England Biolabs, E8032S, 1:200 dilution), followed by anti-mouse IgG-HRP (Sigma ...
-
bioRxiv - Developmental Biology 2021Quote: ... and NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... and NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2019Quote: ... Bound antibodies were detected by incubation with DyLight 800-conjugated secondary antibody (New England BioLabs). An InnoScan 710-IR scanner (Innopsys ...
-
bioRxiv - Cancer Biology 2024Quote: ... Bound antibodies were detected by incubation with DyLight 800-conjugated secondary antibodies (New England BioLabs), and analysed using an InnoScan 710-IR scanner (Innopsys) ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse α-myc (New England Biolabs, clone 9B11, 1:2,000), rabbit α-pol-I largest subunit 15 (1:100 ...
-
bioRxiv - Genetics 2024Quote: ... and mid-range PFG ladder (for mouse samples) (NEB Inc.) and 1 kb ladder (GeneDirex Inc.) ...
-
bioRxiv - Cell Biology 2024Quote: ... was amplified from mouse cDNA by polymerase chain reaction (NEB, M0492L) using primers below:
-
bioRxiv - Molecular Biology 2021Quote: Myc-Tag (9B11) antibody (NEB 2276 S) and mouse IgG (Santa Cruz sc-2025 ...
-
bioRxiv - Physiology 2020Quote: ... Membranes were washed with TBS-T and then incubated with an anti-rabbit horseradish peroxidase conjugated secondary antibody (New England Biolabs, 1:10,000 in 5% skim milk in TBS-T) for 2h ...
-
bioRxiv - Neuroscience 2022Quote: ... or the NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350, NEB) (replicates 4-5 and no salt treatment ...
-
bioRxiv - Molecular Biology 2022Quote: ... Butyryl-Histone H3 (Lys 23) mouse mAb (PTM Biolabs, SKU: PTM 307), Butyryl-Histone H4 (Lys 8 ...
-
bioRxiv - Genomics 2020Quote: Mouse NIH/3T3 and human Jurkat DNA were from NEB (Ipswich, MA), and XP12 phage DNA was obtained from Dr ...
-
bioRxiv - Molecular Biology 2022Quote: ... we used NEBNext® rRNA Depletion Kit (Human/Mouse/Rat) (NEB #E7405), NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® (NEB #E7765 ...
-
bioRxiv - Genetics 2023Quote: ... using the NEBNext rRNA Depletion Kit v2 (Human/Mouse/Rat) (NEB E7405) or the NEBNext Poly(A ...
-
bioRxiv - Biochemistry 2023Quote: ... custom-made rabbit polyclonal anti-AcK142 or anti-AcK226 (Ez Biolabs) Abs were incubated overnight at 4 °C with the lysate from mock vs ...
-
bioRxiv - Biochemistry 2020Quote: ... Primary antibodies used were: New England Biolabs (NEB), Hitchin ...
-
bioRxiv - Genomics 2019Quote: ... mouse NIH/3T3 and human Jurkat DNA were from NEB (Ipswich, MA, USA). E14 genomic DNA was extracted with a DNeasy Blood and Tissue Kit (QIAGEN ...
-
bioRxiv - Genetics 2020Quote: ... following rRNA depletion using a NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB).
-
bioRxiv - Developmental Biology 2023Quote: Regulatory elements were amplified from mouse genomic DNA with Q5 polymerase (NEB, M0491) using primers listed in Table S8 and cloned into pGL4.24[luc2P/minP] (Promega ...
-
bioRxiv - Developmental Biology 2020Quote: ... Anti-SUZ12 (NEB, 3737), Anti-ASXl1 (Cell Signaling ...
-
bioRxiv - Immunology 2019Quote: ... anti-LC3β (NEB, 3868), anti-calnexin (#2433 ...
-
bioRxiv - Cell Biology 2021Quote: ... and anti-SNAP (NEB) antibodies ...
-
bioRxiv - Systems Biology 2023Quote: ... and anti-MBP (NEB) monoclonal antibodies before proceeding ...
-
bioRxiv - Plant Biology 2023Quote: ... and anti-MBP (NEB) antibodies.
-
bioRxiv - Genetics 2024Quote: ... Anti-rabbit (#7074, NEB) and anti-mouse (#7076 ...
-
bioRxiv - Immunology 2022Quote: The antibody expression vectors for each recombinant antibody (VH + VL-L/k) were transfected together with a Transposase vector (Hera BioLabs, USA). Cells were selected with Hygromycin B (H3274 ...
-
bioRxiv - Microbiology 2021Quote: ... Nitrocellulose membrane-transferred proteins were incubated with anti-PfGet3 or anti-MBP (NEB), probed with corresponding HRP-conjugated secondary antibodies and developed by chemiluminescence.
-
bioRxiv - Neuroscience 2022Quote: ... and probed with p62 antibody (NEB D5L7G, 1:800) and streptavidin-594 (Biolegend 405240 ...
-
bioRxiv - Neuroscience 2023Quote: ... TCF/LEF family antibody sampler kit (New England BioLabs), NFAT1 (New England BioLabs) ...
-
bioRxiv - Neuroscience 2021Quote: ... Plasmids encoding mouse Nav1.2 (NP_001092768.1) and Nav1.6 (NP_001070967.1) were cloned by Gibson Assembly (NEB) with synthetic gBlocks gene fragments (Integrated DNA Technologies) ...