Labshake search
Citations for New England Biolabs :
201 - 250 of 3283 citations for L β Homo β 2 hydroxyphenyl glycine; R 3 Amino 3 2 hydroxyphenyl propanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... Pu TKamplicon (5’-CTGTTTTCATTCTGCCTTTTGACCATAGAGCCCACCGCATCC-3’ and 5’-GCCAACAAAGAAAGCCTCACTACC GGGTAGGGGAGGCG -3) and Gibson Assembly master mix (NEB) following the manufacturer’s guidelines.
-
bioRxiv - Biochemistry 2021Quote: ... 2 μL of 2% SDS and 2 μL of proteinase K (New England Biolabs) were added and the solution was incubated at 37°C for 1 hour before purification with the Qiagen DNA clean up kit ...
-
bioRxiv - Plant Biology 2023Quote: ... and MpERF20 cds in situ R (5’ GTACAAGAAAGCTGGGTCGGCGCGCCttacatgagtgggggaactaaaagaagagt-3’) and seamlessly cloned using NEBuilder HiFi DNA Assembly (New England Biolabs, #E5520) into pENTR-D linearized with NotI/AscI ...
-
bioRxiv - Neuroscience 2024Quote: ... 5’UTR - GluA1flip(R) - 3’UTR and GluA3 flip(Q) (Y454A/R461G) was obtained using the Q5® Site-Directed Mutagenesis Kit (NEB). To obtain Halo-tag - GluA2flip(Q ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 μl 10X NEBuffer 2 (New England Biolabs) and nuclease-free water (total of 20 μl ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 ml of Thermolabile ExoI (BioLabs) was added to each reaction and samples were incubated for 15 min at 37 °C ...
-
bioRxiv - Bioengineering 2021Quote: 3 μL of 5′-deadenylase (NEB) were added to ligation reaction,
-
bioRxiv - Molecular Biology 2021Quote: ... Then 3 μl USER Enzyme (NEB) was used with size-selected ...
-
bioRxiv - Neuroscience 2020Quote: ... 3’ overhangs removed with Klenow (NEB) to form blunt ends ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 µl T4 DNA ligases (NEB), and 2 µl of a 15 µM Illumina indexed adapter at room temperature for 1 hour ...
-
bioRxiv - Microbiology 2020Quote: ... 3 μL 10xDNase I Buffer (NEB), and 24 μL WB2 ...
-
bioRxiv - Genomics 2023Quote: ... 3 µL 10x NEBuffer 4 (NEB), 3 µL of 1 mM each dATP/ddCTP/ddGTP/ddTTP (dATP/ddBTP ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 3 μl QuickCIP enzyme (NEB) at 37°C for 10 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... and 3 µL RNase A (NEB) in volumes normalized to OD600 of culture samples ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 3 μL USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Microbiology 2023Quote: ... 3 µL 10x reaction buffer (NEB), 0.25 µl 1 M MgCl2 and 0.3 µl Rnasin ribonuclease inhibitor (Promega ...
-
bioRxiv - Neuroscience 2023Quote: ... Then 3 μL USER Enzyme (NEB) was used with size-selected ...
-
bioRxiv - Genomics 2023Quote: ... Klenow Fragment (3’→5’ exo-) (NEB) was diluted in 1X NEBuffer 2 to a final concentration of 2 U/μL ...
-
bioRxiv - Plant Biology 2022Quote: ... and 3 (NEB, catalog No. E7500S) following manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... 3 µl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Genomics 2024Quote: ... 3 µL 10x ThermoPol buffer (NEB), 3 µL H2O and Therminator IX (NEB 10 U/µL ...
-
bioRxiv - Microbiology 2024Quote: ... and 3 μL of QuickCIP (NEB). The reaction was incubated at 27°C for 20 minutes followed by inactivation at 80°C for 2 minutes ...
-
bioRxiv - Genomics 2024Quote: ... 3 µl of USER (NEB # E7103L) was added for 20 min at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 μl of XbaI (NEB R0145S) was used to digest 6 μg of the pcDNA3.1-Cas9 vector ...
-
bioRxiv - Systems Biology 2024Quote: ... 3 µL BsiWI-HF (NEB, R3553), 3 µL MluI-HF (NEB ...
-
bioRxiv - Systems Biology 2024Quote: ... 3 µL MluI-HF (NEB, R3198), and nuclease-free water to 150 µL at 37 °C for 1 hour ...
-
bioRxiv - Bioengineering 2024Quote: ... Five ligation reactions (20 µL each) were set up using 100 ng DNA (3:1 ratio of library to backbone) and T4 ligase (NEB). Ligation occurred at room temperature for 30 minutes ...
-
bioRxiv - Biochemistry 2021Quote: ... This was added to 5 ml (per 2 L of culture) amylose resin (New England Biolabs) equilibrated in lysis buffer and left on a tube roller shaker at 4 °C for 1 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... separated by the SIM sequence (amino acids 469-478) going outwards using Q5 polymerase (NEB). PCR product was purified ...
-
bioRxiv - Synthetic Biology 2020Quote: ... DNA was recovered by adding 0.1 gel volumes of β-agarase I reaction buffer (NEB), melting gel slices briefly at 65°C ...
-
bioRxiv - Bioengineering 2024Quote: ... coli DH5α (Matthew Scott Lab, University of Waterloo) and NEB10-β (New England Biolabs (NEB), Whitby ...
-
bioRxiv - Bioengineering 2024Quote: ... coli DH5α (Matthew Scott Lab, University of Waterloo) and NEB10-β (New England Biolabs (NEB), Whitby ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... High molecular weight (HMW) DNA was released from the agarose blocks using β-agarase (NEB).
-
bioRxiv - Bioengineering 2022Quote: ... coli NEB 10-β and BL21 (DE3) strain (both from New England BioLabs, Ipswich, USA) with pRI952 plasmid used for all fermentations ...
-
bioRxiv - Molecular Biology 2020Quote: ... the 3’ adapter was first ligated using 0.5 μl of 3’SR Adapter for Illumina (NEB-kit) added to 30 ng of input RNA diluted in 3.0 μl nuclease free H2O ...
-
bioRxiv - Plant Biology 2021Quote: ... The antisense strand with a 3′ phosphate was radiolabeled by T4 Polynucleotide Kinase (3’ phosphatase minus) (NEB) and [γ-32P]ATP ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 μL of GlycoBuffer 2 (NEB Cat # B0701S, 10X), 2 μL of 10% NP-40 (NEB Cat # B0701S ...
-
bioRxiv - Systems Biology 2024Quote: ... 2 µl of NEBuffer 2 (New England Biolabs B7002) and 1 µl of Klenow large fragment DNA polymerase (New England Biolabs M0210 ...
-
bioRxiv - Microbiology 2021Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2020Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-F ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Cell Biology 2024Quote: Homo sapiens cDNAs were amplified by PCR using Q5 High Fidelity DNA Polymerase (New England Biolabs) and sub-cloned into a variety of vector backbones as indicated in the figure legends ...
-
bioRxiv - Microbiology 2022Quote: BACTH constructs made for homo- and heterotypic interaction analysis were created using the HiFi Cloning (NEB) protocol ...
-
Competition co-immunoprecipitation reveals interactors of the chloroplast CPN60 chaperonin machinerybioRxiv - Molecular Biology 2023Quote: ... with oligos 5’-GGTGGTTGCTCTTCCAACGCTGACGCTAAGGAGATTGTG-3’ and 5-GGTGGCATATGTTAGATGGTCATGCCGGAGG-3’ and cloned with SapI and NdeI into Tyb21 (NEB), giving pFW38 ...
-
bioRxiv - Molecular Biology 2023Quote: ... mixed with 3 µl T4 DNA ligase and 3 µl T4 DNA ligase buffer (New England Biolabs, M0202S), and incubated at 25°C overnight (16 hr) ...
-
bioRxiv - Genomics 2022Quote: ... The RNA was capped by adding 0.5 mM of 3’-desthiobiotin-GTP (3’-DTB-GTP) (New England Biolabs), 50 units of Vaccinia Capping Enzyme (New England Biolabs) ...
-
bioRxiv - Biochemistry 2024Quote: ... N-glycanase treatment was performed by dissolving the samples in 50 mM Tris-HCl (pH 8.0) and 10 nM ethylenediaminetetraacetic acid (EDTA) containing 3 units/μL PNGaseF (New England BioLabs, Inc. MA, USA) and incubated for 4 h at RT ...
-
bioRxiv - Cancer Biology 2021Quote: ... Then 3 μl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Genetics 2021Quote: ... 10μl Klenow (3’-5’ exo-) (M0202L, NEB), and 420μl H2O with 1 hr incubation at room temperature and then subjected to proximity ligation by adding 200μl 5× ligation buffer (B6058S ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3 U of T4 DNA polymerase (NEB), 9 U of T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... Primary antibodies (Anti-3-hydroxybutyryllysine [PTM Biolabs 1201] ...