Labshake search
Citations for New England Biolabs :
201 - 250 of 555 citations for Eukaryotic Peptide Chain Release Factor GTP Binding Subunit ERF3A GSPT1 Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... PCR-product and linearized vector containing the constant part of IgG1 heavy or kappa/lambda light chain sequences respectively were assembled using Gibson cloning with HiFi DNA Assembly Master Mix (NEB). Cloning was considered successful when sequence identity was >99.5% as verified by the cBASE module of BASE software ...
-
bioRxiv - Neuroscience 2021Quote: ... The polymerase chain reaction (PCR) was performed on a genomic rat DNA template using a Taq PCR Kit (New England Biolabs), and the subsequent PCR product was purified using a Qiagen PCR Purification Kit (Life Technologies ...
-
bioRxiv - Neuroscience 2021Quote: ... The polymerase chain reaction was performed using a 50 µL master mix consisting of 1x standard Taq buffer (New England Biolabs), LCO1490 primer (0.2 mM) ...
-
bioRxiv - Immunology 2021Quote: ... The PCR products were run on 1% Agarose gel and those with correct heavy and light chain bands were then used for Gibson ligation (New England Biolabs), cloning into human IgG expression vectors ...
-
bioRxiv - Plant Biology 2021Quote: ... Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) analyses were performed using Luna Universal Probe One-Step qRT-PCR Kit (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Polymerase chain reactions were performed with 15 μL Phusion® High-Fidelity PCR Master Mix (New England Biolabs, Ipswich, USA), 0.2 μM of forward primer ...
-
bioRxiv - Biochemistry 2020Quote: ... Synthesized first-strand complimentary DNA was used to amplify the heavy-chain variable domains using Q5 high-fidelity DNA polymerase (New England Biolabs) and the described primers (CALL001 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... the templates were prepared by polymerase chain reaction (PCR) amplification from corresponding plasmid constructs using Q5 DNA Polymerase Master Mix (NEB). The PCR reaction was worked up using a Qiagen PCR purification kit ...
-
bioRxiv - Molecular Biology 2021Quote: ... Genes were amplified in polymerase chain reactions (PCRs) using oligonucleotides with XhoI and KpnI restriction site overhangs and digested with the respective enzymes (NEB). pcDNA3.1 (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... these fragments were amplified by Polymerase Chain Reaction using Phusion® High-Fidelity DNA Polymerase (M0530L, New England Biolabs (NEB)) using 35 cycles with an annealing temperature of 60 °C (see table 2 for list of primers ...
-
bioRxiv - Cell Biology 2022Quote: ... The pDyn1 plasmid [the pACEBac1 expression vector containing insect cell codon-optimized dynein heavy chain (DYNC1H1) fused to an amino-terminal His-ZZ-TEV tag and a SNAPf tag (New England Biolabs) on the carboxy-terminus] and the pDyn2 plasmid (the pIDC expression vector with codon optimized DYNC1I2 ...
-
bioRxiv - Microbiology 2020Quote: ... The PCR products were run on 1% Agarose gel and those with correct heavy and light chain bands were then used for Gibson ligation (New England Biolabs), cloning into IgG expression vectors ...
-
bioRxiv - Systems Biology 2020Quote: ... Open Reading Frames (ORFs) were amplified by polymerase chain reaction (PCR) from the templates indicated in Table S7 using Phusion DNA polymerase (NEB) with Gateway compatible sequences appended to the end of the primers (5’ sequence - gggg aca act ttg tac aaa aaa gtt ggc acc ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Tetravalent antibody constructs were generated by fusing these fragments with their respective IgG heavy chain in the pSCSTa mammalian expression vector using Gibson assembly (NEB). Fab-IgG constructs were arranged by fusing a heavy chain Fab domain to the N-terminus of the IgG via a S(G4S)3 linker ...
-
bioRxiv - Synthetic Biology 2020Quote: ... inverted PgolB promoter with Bxb1 recognition sites and reporter-terminator (GFP-rrnBT1) pair were amplified by polymerase chain reaction (PCR) using Q5 High-Fidelity DNA Polymerase (M0491, NEB) in thermal cycler (C1000 Touch ...
-
bioRxiv - Microbiology 2021Quote: ... All polymerase chain reactions were performed using 15 μL of Phusion® High-Fidelity PCR Master Mix (New England Biolabs), 0.2 μM of each forward and reverse primer and 10 ng of DNA template ...
-
bioRxiv - Pathology 2021Quote: Reverse-transcription polymerase chain reaction (RT-PCR) was performed using the Luna Universal Probe One-Step RT-qPCR kit (NEB). Two gene targets were used for SARS-CoV-2 RNA detection ...
-
bioRxiv - Bioengineering 2022Quote: All gene amplifications were performed using polymerase chain reaction (PCR) in a 50 µL mix with Q5 High-Fidelity DNA Polymerase (New England Biolabs) according to the manufactureŕs protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... It was followed by a second In-Fusion HD cloning of a polymerase chain reaction using 5’-GAAGGGGATCCACCGATGGTGAGCAAGGGCGAGG-3’ / 5’-TTAGTAGCTCTAGACTTGTACAGCTCGTCCATGCC-3’ (mScarlet insert) using BamHI and XbaI (New England Biolabs).
-
bioRxiv - Immunology 2022Quote: Fab fragments were generated by inserting a stop codon six amino acids upstream of the hinge region (CPPCP) of the heavy chain expression plasmid using the Q5 Site-Directed Mutagenesis Kit (New England BioLabs). This mutagenized plasmid was co-transfected with the respective light chain plasmid ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... We amplified the wild-type EST1 gene from the genome of the haploid strain BY4742 by polymerase chain reaction (PCR) using the high-fidelity Q5 polymerase (NEB) and inserted it into the ΔEST1 cells used in [1] by CRISPR/Cas9 editing ...
-
bioRxiv - Neuroscience 2022Quote: ... The heavy-chain variable domain was then amplified from the cDNA using Q5 high-fidelity DNA polymerase (New England Biolabs) with the described primers (CALL001 ...
-
bioRxiv - Immunology 2022Quote: ... and Illumina linker addition to B cell heavy chain transcripts were performed using the human NEBNext Immune Sequencing Kit (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... The resulting fragments were amplified using ligation-mediated polymerase chain reaction (LM-PCR) with Q5 Hot Start High-Fidelity 2X Master Mix (NEB) to allow the addition of homology arms necessary for cloning ...
-
bioRxiv - Immunology 2024Quote: ... The remainder of the adapter sequences were added to the heavy and light chains separately by a two-step PCR reaction with Q5 using the NEBNext index primers (NEB) 98°C for 30s ...
-
Bacteria Are a Major Determinant of Orsay Virus Transmission and Infection in Caenorhabditis elegansbioRxiv - Microbiology 2024Quote: ... homology arms flanking the region to be deleted were obtained using polymerase chain reaction (PCR) and cloned into the pExG2-KanR suicide vector using Hi-Fi Assembly (New England Biolabs)70 ...
-
bioRxiv - Biochemistry 2023Quote: ... the MsbA gene (from Escherichia coli genomic DNA) was amplified by polymerase chain reaction (PCR) using Q5 High-Fidelity DNA Polymerase (New England Biolabs, NEB) and subcloned into a modified pCDF-1b plasmid (Novagen ...
-
bioRxiv - Molecular Biology 2023Quote: ... was also reverse-transcribed and Illumina sequencing library prep was followed by 8–10 cycles of polymerase chain reaction (PCR) using High Fidelity Phusion (New England Biolabs). All the libraries were barcoded in the PCR step ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The isolated DNA and the initial infectious plasmid were used as DNA template for polymerase chain reaction (PCR) using 30 cycles and the Q5 High Fidelity DNA Polymerase (New England BioLabs) under the recommended conditions by the manufacturer ...
-
bioRxiv - Cell Biology 2023Quote: ... we quantitated the proportion of abnormal DNA fragments generated by the procedure using DNA prepared from the transfected cell population and a polymerase chain reaction (PCR)-based T7 endonuclease assay (New England BioLabs). The PCR was performed with primers flanking the predicted ligation-junction product (forward primer AGAATACCAGGGGGCCATGA and reverse primer AACGAATCCTTTCCCTGGGTC) ...
-
bioRxiv - Neuroscience 2023Quote: ... Mice were genotyped by polymerase chain reaction (PCR) using isopropanol-precipitated genomic DNA as template and OneTaq DNA polymerase (New England Biolabs, (NEB), #M0480 ...
-
bioRxiv - Neuroscience 2023Quote: ... as wildtype or T205A variant were amplified by polymerase chain reaction (PCR) using Q5 High-Fidelity master mix (M0492, New England Biolabs (NEB)) from previous plasmid constructs 16 ...
-
bioRxiv - Genetics 2023Quote: ... The presence of infectious rIBV in the allantoic fluid was confirmed by a two-step reverse transcription polymerase chain reaction (RT-PCR) protocol using Protoscript II reverse transcriptase (NEB) and the random primer 5′-GTTTCCCAGTCACGATCNNNNNNNNNNNNNNN-3′ for the RT step and recombinant Taq polymerase (Invitrogen ...
-
bioRxiv - Immunology 2024Quote: ... Donor and destination plasmids were combined in a single digestion-ligation reaction to generate an expression plasmid encoding the heavy and light chains with BsaI-HF (NEB) and T4 ligase (NEB) ...
-
bioRxiv - Plant Biology 2024Quote: ... The ITS region was amplified by polymerase-chain reaction (PCR) using the Phusion High-Fidelity DNA Polymerase (M0530L, New England Biolabs) and the following primers (as reported in (Jaramillo et al ...
-
bioRxiv - Genetics 2024Quote: ... 128 μL of sample was amplified in 400 μL polymerase chain reactions (PCRs) across 8 PCR tubes using Q5 High-Fidelity DNA Polymerase (NEB). Primers contained partial Illumina adapters ...
-
bioRxiv - Molecular Biology 2020Quote: ... polyadenylated RNA was purified by two rounds of binding to Oligo (dT)25 magnetic beads (NEB) and mRNA was fragmented with RNA fragmentation solution (Ambion ...
-
bioRxiv - Microbiology 2021Quote: ... SMU_313 with mutated SmsR4-binding site was constructed using the Q5 Mutagenesis Kit (New England Biolabs) and mutations were confirmed through Sanger sequencing.
-
bioRxiv - Developmental Biology 2020Quote: ... followed by mutation of the MAO binding site using the Q5 site directed mutagenesis kit (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: Antigen binding fragment (Fab) was generated by incubating IgG with LysC (New England Biolabs, Cat# P8109S) at a ratio of 1 μg LysC per 10mg IgG at 37°C for 18hrs ...
-
bioRxiv - Immunology 2020Quote: ... Antigen binding fragment (Fab) was generated by incubating IgG with LysC (New England Biolabs, Cat# P8109S) at a ratio of 1μg LysC per 10mg IgG at 37°C for 18hrs ...
-
bioRxiv - Biochemistry 2022Quote: ... CBP (Chitin Binding Protein, produced by N. Martín in Dr. Casanova’s lab, New England Biolabs Protocol) was used as a secondary antibody at 1:300 to detect chitin and visualize the tracheal branches ...
-
bioRxiv - Genomics 2022Quote: ... a second bead binding was performed followed by a 5’ de-capping using RppH (NEB M0356S). The 5’ end of the transcript was phosphorylated using PNK (NEB M0201L ...
-
bioRxiv - Bioengineering 2023Quote: ... the AsCas12a-crRNA complexes were combined with 1 µL of binding buffer (New England BioLabs, #B6002S), 4.5 µL of biotinylated quencher probes ...
-
bioRxiv - Cell Biology 2024Quote: ... Assembly of each factor was done using NEB HiFi 2X mastermix (NEB Cat. No. E2621L) with 50 ng of digested backbone and 10-40ng of gel purified cDNA following standard protocol from NEB ...
-
bioRxiv - Biochemistry 2021Quote: Peptide-N-glycosidase F (PNGase F) (New England Biolabs Inc., Cat. P0704S) was used for complete removal of N-linked oligosaccharides ...
-
bioRxiv - Plant Biology 2020Quote: ... 1.5 μg of biotinylated histone peptides were incubated with streptavidin beads (NEB) in binding buffer (50 mM Tris-HCl 8.0 ...
-
bioRxiv - Cell Biology 2023Quote: ... separated via self-cleaving T2A peptide was generated via Gibson Assembly (NEB). This cassette including a 5’ chimeric intron and 3’ poly adenylation signal sequence replaces the sequence of Pax7 exon 1 immediately 3’ of the ATG start codon ...
-
bioRxiv - Neuroscience 2020Quote: Overlapping fragments of the unstable NaV1.1 cassette-3 were amplified in polymerase chain reactions (PCR) using Q5® Hot Start High Fidelity 2x Master mix (New England Biolabs) and the primer pairs listed in Table S1 ...
-
bioRxiv - Biochemistry 2020Quote: ... Novel mutants of Ecm2 were generated using inverse polymerase chain reaction (PCR) with Phusion DNA polymerase (New England Biolabs; Ipswich, MA). All plasmids were confirmed by sequencing.