Labshake search
Citations for New England Biolabs :
201 - 250 of 3326 citations for ESM 1 Mouse HEK 293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2022Quote: ... The Hi-C library for Illumina sequencing was prepped by NEBNext Ultra II DNA library Prep Kit for Illumina (NEB Cat# E7645S) according to the manufacturers’ instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... Singh et al 2014) were synthesized (Integrated DNA Technologies, Research Triangle Park, NC) and assembled by Hi-Fi assembly (New England Biolabs, Ipswich, MA) into a modified pCAMBIA0380 expression construct (Genbank AF234290.1 ...
-
MIIP downregulation promotes colorectal cancer progression via inducing adjacent adipocytes browningbioRxiv - Cancer Biology 2023Quote: ... Miip CDS was amplified by PCR and cloned into LV17 (EF-1α-Luciferase-puro) shuttle vector (GenePharma, Shanghai, China) with restriction enzymes Not I and Bam HI (New England Biolabs, Ipswich, MA). For mouse Miip specific knock-down ...
-
bioRxiv - Biochemistry 2024Quote: ... Digestion was set up to remove the 6X-His-tag by incubating with either homemade or store bought (NEB, Cat. no: P8070L) enterokinase in the presence of 10mM CaCl2 at 22°C for 16h ...
-
bioRxiv - Developmental Biology 2020Quote: ... 75°C) with 0.5 μg mouse Cot-1 DNA supplemented with 10 mM vanadyl ribonucleoside complex (VRC) (NEB, S1402S) and 0.2 U μL−1 RNAseOUT (Invitrogen ...
-
bioRxiv - Biochemistry 2023Quote: ... The coding sequence of mouse PADI4 (residues 1-666) was amplified and cloned into pET28a vector using NdelI (NEB) and XhoI (NEB ...
-
bioRxiv - Immunology 2021Quote: Restriction digest of pEX-K4 plasmid DNA containing EtAMA1Cit or was performed using Bam HI and Xho I (New England Biolabs, Ipswich, MA, USA) to extract tagged antigen coding sequences for cloning into pYD1 plasmid vector ...
-
bioRxiv - Biochemistry 2024Quote: N-term-His-ELMO1C438A construct was generated from N-term-His-ELMO1 construct obtained above using Q5® Site-Directed Mutagenesis Kit (New England BioLabs, cat # E0554S), with the following primers.
-
bioRxiv - Biochemistry 2021Quote: ... mouse anti-MBP monoclonal (NEB), anti-mouse-HRP (Dianova) ...
-
bioRxiv - Developmental Biology 2021Quote: Subcloning Both full-length and truncated (1-160) mouse Naa12 were amplified from the pMAL-c5x Naa12 plasmid using Q5 HF Master Mix (NEB), AAAACCCGGGTATGAACATCCGCCGGGCTCGGC as the forward primer ...
-
bioRxiv - Molecular Biology 2022Quote: ... dsRNA was synthesized from T7-linked DNA using the HI Scribe™ T7 High Yield RNA Synthesis Kit (New England, Biolabs, Ipswich, MA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse monoclonal anti-MBP (NEB, E8032). Peroxidase and Alexa-fluor conjugated secondary antibodies were purchased from Jackson Laboratories and ThermoFisher ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-myc (New England Biolabs), rabbit polyclonal anti- GFP (gift from Oliver Gruss ...
-
bioRxiv - Developmental Biology 2021Quote: ... DNA was amplified with 12 cycles of PCR using the NebNext Hi-Fi 2X PCR Master Mix (New England Biolabs Inc, Ipswich, MA, Cat #M0541S). Following PCR ...
-
bioRxiv - Genomics 2019Quote: ... were ligated onto Hi-C ligation products bound to streptavidin beads for 2 hours at room temperature (T4 DNA ligase NEB, in ligation buffer, slowly rotating). After washing twice with wash buffer (5 mM Tris ...
-
bioRxiv - Molecular Biology 2021Quote: ... GGGMcm3 (in association with the other Mcm2-7 subunits) was cleaved off the resin with 500 units of 7×His-TEV protease (NEB; rotation overnight at 4°C). The flow-through was collected and applied to 0.4 mL volume Ni-NTA Agarose resin (Qiagen ...
-
bioRxiv - Microbiology 2022Quote: ... The reaction was performed in temperature cycles of 37°C for 2 min and 16°C for 5 min using the restriction enzyme Bsa I-HF® V2 and the Hi-T4™ DNA ligase (from New England Biolabs; Bioconcept, Allschwil, Switzerland), followed by a final 10 min ligation at 16°C ...
-
bioRxiv - Neuroscience 2022Quote: ... Ribo-Zero Gold (Human/Mouse/Rat) Kit (Illumina; NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350, NEB); NEXTflex™ Small RNA Sequencing Kit v3 (PerkinElmer ...
-
bioRxiv - Microbiology 2020Quote: ... with rotation for 1 hour at room temperature followed by further incubation for 1 hour with the addition of 15 μl of goat anti-mouse IgG magnetic beads (New England Biolabs, Ipswich, MA, USA). The magnetic beads in the supernatant were collected on a magnetic stand and washed 2 times with PBS ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-MBP (New England Biolabs, RRID:AB_ 1559738), used at 1:5000 ...
-
bioRxiv - Cancer Biology 2019Quote: ... mouse monoclonal anti Pan-Keratin (clone C11, NEB, 4545S). Primary antibodies were incubated with sections overnight at 4°C except for anti-CD3 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... and NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2023Quote: ... mouse monoclonal antibodies against PAR (clone 10H, Tulip BioLabs, USA), anti-mouse antibodies conjugated with horseradish peroxidase (Bio-Rad ...
-
bioRxiv - Genetics 2024Quote: ... and mid-range PFG ladder (for mouse samples) (NEB Inc.) and 1 kb ladder (GeneDirex Inc.) ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-Maltose Binding Protein monoclonal antibody IgG2a (New England Biolabs), mouse anti-Histone H3 [Trimethyl Lys9] 6F12-H4 (Novus Biologicals) ...
-
bioRxiv - Cell Biology 2024Quote: ... was amplified from mouse cDNA by polymerase chain reaction (NEB, M0492L) using primers below:
-
bioRxiv - Molecular Biology 2020Quote: ... antibody were incubated with 25 µL of magnetic anti-mouse beads (NEB) overnight ...
-
bioRxiv - Neuroscience 2022Quote: ... or the NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350, NEB) (replicates 4-5 and no salt treatment ...
-
bioRxiv - Molecular Biology 2022Quote: ... Butyryl-Histone H3 (Lys 23) mouse mAb (PTM Biolabs, SKU: PTM 307), Butyryl-Histone H4 (Lys 8 ...
-
bioRxiv - Genomics 2020Quote: Mouse NIH/3T3 and human Jurkat DNA were from NEB (Ipswich, MA), and XP12 phage DNA was obtained from Dr ...
-
bioRxiv - Molecular Biology 2022Quote: ... we used NEBNext® rRNA Depletion Kit (Human/Mouse/Rat) (NEB #E7405), NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® (NEB #E7765 ...
-
bioRxiv - Genetics 2023Quote: ... using the NEBNext rRNA Depletion Kit v2 (Human/Mouse/Rat) (NEB E7405) or the NEBNext Poly(A ...
-
bioRxiv - Genomics 2019Quote: ... mouse NIH/3T3 and human Jurkat DNA were from NEB (Ipswich, MA, USA). E14 genomic DNA was extracted with a DNeasy Blood and Tissue Kit (QIAGEN ...
-
bioRxiv - Microbiology 2020Quote: ... or anti-mouse IgG (H+L) (DyLight™ 800 4X PEG Conjugate, NEB) were used as the secondary antibodies.
-
bioRxiv - Genetics 2020Quote: ... following rRNA depletion using a NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB).
-
bioRxiv - Developmental Biology 2023Quote: Regulatory elements were amplified from mouse genomic DNA with Q5 polymerase (NEB, M0491) using primers listed in Table S8 and cloned into pGL4.24[luc2P/minP] (Promega ...
-
bioRxiv - Neuroscience 2021Quote: ... Plasmids encoding mouse Nav1.2 (NP_001092768.1) and Nav1.6 (NP_001070967.1) were cloned by Gibson Assembly (NEB) with synthetic gBlocks gene fragments (Integrated DNA Technologies) ...
-
bioRxiv - Cell Biology 2022Quote: Mouse phogrin was obtained from the IMAGE consortium (clone BC_133678) and CLIPf from NEB. The fusion protein was generated by standard molecular cloning techniques ...
-
bioRxiv - Neuroscience 2020Quote: ... Mouse Adnp was amplified from pENTR223.1-Adnp using Q5 High Fidelity DNA Polymerase (NEB) and primers containing 6xHis tag to insert it into the C-terminal region of Adnp ...
-
bioRxiv - Genomics 2022Quote: ... 1 μl of Exonuclease 1 (NEB, M0293S) was added to each PCR product and incubated at 37C for 15 min to digest any single-stranded product ...
-
bioRxiv - Molecular Biology 2024Quote: ... in 1× NEB buffer 1 (NEB, B7001S) for 15 min at 37°C ...
-
bioRxiv - Biochemistry 2023Quote: ... 1% cholorophorm was added together with 10 μg mL-1 DNase 1 (NEB) and 1 μg mL-1 RNase A ...
-
bioRxiv - Molecular Biology 2021Quote: ... depleted with the NEBNext rRNA Depletion Kit (Human/Mouse/Rat, NEB, Figures 6 and S6), or not depleted (Figures 2B ...
-
bioRxiv - Genomics 2022Quote: For each of the two ligation-based protocols used for mouse sperm (Truseq, NEB Next), two replicate libraries for mouse sperm were prepared with the additional condition of an 18 hour ligation at 16°C for the ligation of the 3’ adapter in the attempt to increase ligation efficiency ...
-
bioRxiv - Cancer Biology 2023Quote: ... Ribosomal RNA was removed using NEBNext® rRNA Depletion Kit (Human/Mouse/Rat; NEB, E6310X). rRNA-depleted RNA was converted to a library using NEBNext® Ultra™ II Directional RNA Library Prep Kit (NEB ...
-
bioRxiv - Microbiology 2022Quote: The recombinant constructs (pETDuet-1-TaPHB-1 and pETDuet-1-TaPHB-1-RUVBL1 were separately transformed into E. coli Lemo21(DE3) (NEB) chemical competent cells ...
-
bioRxiv - Molecular Biology 2023Quote: ... Unincorporated ddRTP molecules were inactivated by adding 1 µL of Buffer 2 (80 mM MgCl2) and 1 µL of 1:1 rSAP (NEB):50% glycerol ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 mM MgCl2) supplemented with 1 mM ATP and 1 U/μL RNase Inhibitor (NEB). Reaction was incubated for 1 hour at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... Clean RNA was first rRNA depleted using the NEBNext rRNA depletion kit (Human/Mouse/Rat) (NEB) before being prepared for sequencing using the NEBNext Ultra II Directional RNA Library Prep Kit (NEB ...