Labshake search
Citations for New England Biolabs :
201 - 250 of 5904 citations for 6 METHOXY 1 2 3 4 TETRAHYDRO NAPHTHALENE 2 CARBALDEHYDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... Monophosphorylated RNAs were ligated to 3′ adapters ( rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/, IDT) using T4 RNA ligase 2 in 25% PEG 8000 (NEB) at 15°C overnight ...
-
bioRxiv - Molecular Biology 2024Quote: 100 ng polyA+ RNA was annealed with 2 μl of 10 μM Oligo(dT)30VN primer (5’-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN-3’) and 2 μl of 10 mM dNTP mix (NEB) in 12 μl solution ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 1 µM gRNA pool (3 gRNAs in total) in 4× Cas9 Reaction Buffer (New England Biolabs) at 25°C for 10 min in a 5 µl reaction volume ...
-
bioRxiv - Molecular Biology 2023Quote: ... Unincorporated ddRTP molecules were inactivated by adding 1 µL of Buffer 2 (80 mM MgCl2) and 1 µL of 1:1 rSAP (NEB):50% glycerol ...
-
bioRxiv - Genetics 2021Quote: ... 2 × 2 µg of gDNA were digested in parallel with 50 units of DpnII (NEB #R0543L) and NlaIII (NEB #R0125L ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 µl T4 DNA ligase buffer and 2 µl 10 mg/ml BSA (New England Biolabs). These reactions were placed in a thermocycler with following program ...
-
bioRxiv - Microbiology 2022Quote: ... 2 µL NEBNext Bacterial rRNA depletion solution and 2 µL Probe Hybridization Buffer (NEB, CN E7850) were mixed with cells on ice ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 mM vanadyl ribonucleoside complex (NEB), 0.02% RNase-free BSA (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 mM Vanadate (Sodium Orthovanadate, NEB, pre-incubated for ten minutes at 95 °C to dissociate Vanadate oligomers ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 μL 10 mM dNTPs (NEB), 9 μL Nuclease-free water ...
-
bioRxiv - Neuroscience 2020Quote: ... 2× Protoscript Buffer (New England Biolabs), 12 mM MgCl2 (ThermoFisher) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 2 μl Q5 polymerase (NEB, M0491), 10 μl Q5 reaction buffer and 31 μl H2O with the following protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 µl 5x Phusion buffer (NEB), 0.2 µl 10 mM dNTPs (NEB) ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 mM Ribonucleoside Vanadyl Complex (NEB), Roche cOmplete™ ...
-
bioRxiv - Genomics 2020Quote: ... + 2 uL DpnI (New England Biolabs) + up to 100 uL water.
-
bioRxiv - Genetics 2020Quote: ... NdeI (NEB, Figure 2 and 5) and SacII (NEB ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 μl BSA (New England Biolabs), 10 μl dNTPs (Thermofisher) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 μl SrfI (New England Biolabs), and MilliQ (until a volume of 50 μl) ...
-
bioRxiv - Systems Biology 2020Quote: ... 2 μL T4 ligase buffer (NEB), 1 μL BsmBI restriction enzyme (ThermoFisher Scientific ...
-
bioRxiv - Developmental Biology 2020Quote: ... 2 mM Vanadyl ribonucleoside complex (NEB), 0.02% RNAse-free BSA (ThermoFisher) ...
-
bioRxiv - Neuroscience 2019Quote: ... and 2 units of HaeIII (NEB) or 10 units of HpaII (NEB ...
-
bioRxiv - Neuroscience 2019Quote: ... and 2 units of HaeIII (NEB), to assess the methylation status of two CpG sites in the promoter region ...
-
bioRxiv - Plant Biology 2020Quote: ... and 2 units Phusion Polymerase (NEB)) ...
-
bioRxiv - Genomics 2022Quote: ... and 2 μL NlaIII (NEB, R0125L) in 100 μL reaction mixture at 37 °C for 30 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... 2 units RNA-free DNAse (NEB) was added and reactions left at 37°C for 30 minutes ...
-
bioRxiv - Bioengineering 2020Quote: ... and Cap 2’-O-Methyltransferase (NEB), followed by another purification by RNA Clean & Concentrator (Zymo) ...
-
bioRxiv - Genomics 2019Quote: ... 2 µL of USER enzyme (NEB) was added directly to each purified PCR product ...
-
bioRxiv - Microbiology 2021Quote: ... and 2 U DNAse I (NEB). Then sonicated on ice for 10 sec and boiled 15’ at 99°C after adding 25 μL of SDS-PAGE 5x loading buffer and resolved by SDS-PAGE ...
-
bioRxiv - Genomics 2019Quote: ... 2 µl of USER enzyme (NEB) was added to the purified assembly reactions and incubated at 37 °C for 15 minutes followed by 15 minutes at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 µl Endo H (NEB P0702S) and 3 µl of G3 reaction buffer (NEB ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 mM vanadyl ribonucleoside complex (NEB), 0.02% RNAse-free BSA (ThermoFisher) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2 μl Q5 polymerase (NEB, M0491), 10 μl Q5 reaction buffer and 31 μl H2O with the following protocol ...
-
bioRxiv - Microbiology 2020Quote: ... After 2 U RNase H (NEB) treatment for 15 min at 37 °C ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μl T4 ligase buffer (NEB), 1 μl T4 ligase (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 µl 5x Q5 buffer (NEB), 0.2 µl 10 mM dNTPs (NEB) ...
-
bioRxiv - Neuroscience 2020Quote: ... 2 μL PNGase F (NEB # P0704) was added to the filter and incubated for 3 h at 37 °C ...
-
bioRxiv - Biophysics 2021Quote: ... and 2’-O-methyltransferase (NEB, M0366), following the one step protocol ...
-
bioRxiv - Biophysics 2022Quote: ... and 2 U/mL YIPP (NEB).50 Af tRNA nucleotidyl transferase was purified with the same method and buffers as the MBP-MS2 fusion protein.38 The reaction was incubated at 37 °C for 2 hours ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2 U M.CviPI (NEB, Cat# M0227S), 160 μM S-adenosylmethionine (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 µl of 10X buffer (NEB), and 833 µM of cytidine 3’-phosphate at 37° C for 1 hour ...
-
Promoter-adjacent DNA hypermethylation can downmodulate gene expression: TBX15 in the muscle lineagebioRxiv - Molecular Biology 2022Quote: ... pCMV-CLuc 2 (New England Biolabs) encoding the Cypridina luciferase was co-transfected with the test construct ...
-
bioRxiv - Zoology 2022Quote: ... mRNA cap 2’-O-methyltransferase (NEB) and E ...
-
bioRxiv - Microbiology 2023Quote: ... 2 µg bovine serum albumin (NEB), 10% glycerol (v/v ...
-
bioRxiv - Bioengineering 2023Quote: ... 10 μL GlycoBuffer 2 (10 ×) (NEB), 10 μL 10% NP-40 (NEB) ...
-
bioRxiv - Microbiology 2023Quote: ... containing 1x NEBuffer 2 (NEB, B7002S), 1 mM ATP ...
-
bioRxiv - Genomics 2023Quote: ... 2 (TOYOBO) and BsaI-HF (NEB) and incubated at 37℃ for 5 min and 16℃ for 5 min for three cycles ...
-
bioRxiv - Genomics 2023Quote: ... 2 µl 10x CustSmart buffer (NEB), 1 µl EcoRI enzyme (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 2µl 10× GlycoBuffer 2 (NEB) buffer at 37°C 1h ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µl 10% NP-40 (NEB) and 2µl 10× GlycoBuffer 2 (NEB ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 µl Q5 DNA Polymerase (NEB). Amplification was done with an initial denaturation at 95 °C for 30 sec followed by 40 cycles at 95 °C for 10 sec ...