Labshake search
Citations for New England Biolabs :
201 - 250 of 1948 citations for 5 Sulfosalicylaldehyde sodium salt since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: An RNA oligonucleotide (5’-GGCATGTGATTGGTGGGTC) was 5’ labelled with gamma 32P ATP by T4 Polynucleotide Kinase (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: ... 5% CO2 -balanced complete cell culture medium with 5 μM SNAP-Surface Alexa Fluor 647 (NEB, S9136S), for 15 minutes at 37°C ...
-
bioRxiv - Neuroscience 2022Quote: ... or 120 μM m7G(5’)ppp(5’)G RNA Cap Structure Analog (M7; New England BioLabs #S1404S) was used ...
-
bioRxiv - Cell Biology 2021Quote: ... Samples were brought up to 50μl and subsequently digested with 1μl of Nuclease P1 in 50mM sodium acetate buffer (New England Biolabs, M0660) for 2h at 45°C ...
-
bioRxiv - Microbiology 2022Quote: ... RNAs were precipitated in cold ethanol and 0.3 M of sodium acetate and dephosphorylated using Calf-intestinal alkaline phosphatase (New England Biolabs), according to manufacturer protocol ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 5’-monophosphate standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with Apyrase (NEB). The 5’-hydroxyl standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with calf intestinal phosphatase (NEB) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 mM of each of the other three dNTPs and 5 U Klenow fragment (3’—>5’ exo-, NEB) in the corresponding buffer ...
-
bioRxiv - Genetics 2022Quote: ... 5 µL of each reaction was combined with 5 µL Phusion Hot Start Flex 2x Master Mix (NEB) and sequences were extended (95 °C 3 min ...
-
bioRxiv - Microbiology 2020Quote: ... 5′-preadenylated oligos oHR546-551 were then ligated to the cDNA using 5′ App DNA/RNA ligase (NEB). Amplification and barcoding PCR was then performed with oligos that annealed to the TSA5 and TSA7 sequences and added i5/i7 and P5/P7 sequences ...
-
bioRxiv - Molecular Biology 2019Quote: ... HIS3_hp_For 5′ AAAAGCTTGACCGAGAGCAA and HIS3_hp_Rev 5′ GCGTATTACAAATGAAACCAAGATTCA) and initially cloned into pRS405 (3) between HindIII and XhoI (NEB). A DNA segment containing the GAL1 promoter ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 mM DTT) and the 5’-ends were phosphorylated with 25 units of T4 Polynucleotide Kinase (NEB #M0201) for 15 min at 37 °C while shaking in a thermomixer at 1000 rpm for an interval of 15 sec every 3 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... Dephosphorylation of the 5’-triphosphate pre-tRNA was done using 5 units QuickCIP (New England Biolabs, cat#M0525S) for 30 minutes at 37°C in 1X rCutSmart Buffer (New England Biolabs ...
-
Competition co-immunoprecipitation reveals interactors of the chloroplast CPN60 chaperonin machinerybioRxiv - Molecular Biology 2023Quote: ... with oligos 5’-GGTGGTTGCTCTTCCAACGCTGACGCTAAGGAGATTGTG-3’ and 5-GGTGGCATATGTTAGATGGTCATGCCGGAGG-3’ and cloned with SapI and NdeI into Tyb21 (NEB), giving pFW38 ...
-
bioRxiv - Neuroscience 2024Quote: ... PCR amplification (primers 5’ GCTTGATTTAGGTGACACTATAGAATAC, 5’ ACTCCCGGGTTAAGCGGTACGGTTGTACAGG) was performed using Phusion High Fidelity DNA polymerase (New England Biolabs) using pCS2 TeNT-LC-GFP as a template (a gift from Martin Meyer) ...
-
bioRxiv - Genomics 2024Quote: ... Nuclei were digested using 800 U of BamHI (for 5’-5’ loop) or BglII (for junction loop) (NEB) on a shaker overnight at 37°C ...
-
bioRxiv - Genetics 2021Quote: ... 10μl Klenow (3’-5’ exo-) (M0202L, NEB), and 420μl H2O with 1 hr incubation at room temperature and then subjected to proximity ligation by adding 200μl 5× ligation buffer (B6058S ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... .5 uL of Phusion polymerase (NEB M0530S), and enough to water to total the reaction volume at 50 uL ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 µL ExoI (20 U/µL, NEB), 7 µL HinFI (10U/µL ...
-
bioRxiv - Bioengineering 2022Quote: ... 5 μL of 5x Phusion buffer (NEB) and 14.25 μL of nuclease-free water ...
-
bioRxiv - Genomics 2022Quote: ... and 1 μl 5’deadenylase (NEB, M0331) into the 20 μl ligation reaction for incubation with 30 minutes at 30°C and 3 minutes at 65°C to inactivate the enzymes followed by column purification (Zymo Research ...
-
bioRxiv - Genomics 2019Quote: ... 5 µL PNK (10 U/µL, NEB) was added ...
-
bioRxiv - Genomics 2020Quote: ... 5 μL of Quick T4 Ligase (NEB) in 1X Quick Ligation buffer (NEB) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5 U Antarctic phosphatase (New England BioLabs) and labeled internal standards were added ([15N2]-cadC 0.04301 pmol ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 µL 32mM S-Adenosyl methionine (NEB) (final concentration 0.8 mM) ...
-
bioRxiv - Cell Biology 2020Quote: ... protein tyrosine phosphatase (PTP, 5 unit; NEB), or sodium orthovanadate (Na3VO4 ...
-
bioRxiv - Biochemistry 2020Quote: ... Klenow 3’ to 5’ exo (NEB: M0212) and Biotin-11-dUTP (40 μM ...
-
Insights into the secondary structural ensembles of the full SARS-CoV-2 RNA genome in infected cellsbioRxiv - Biochemistry 2021Quote: ... 1 μl 5′ deadenylase (New England Biolabs) and 1 μl RNaseOUT ...
-
bioRxiv - Microbiology 2020Quote: ... 5 Us of exo(-) Klenow Fragment (NEB), 200 pmol of NNSR-2 Primer for 30 min at 37°C ...
-
bioRxiv - Genomics 2020Quote: ... and 5 μl Large (Klenow) fragment (NEB) to the DNA at R.T ...
-
bioRxiv - Immunology 2022Quote: ... containing 5 U murine RNase Inhibitor (NEB) using a FACSAriaIII instrument (BD) ...
-
bioRxiv - Microbiology 2020Quote: ... 5 units of restriction enzyme BsaJI (NEB) was directly mixed with 300ng of DNA ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and 5× Q5 High GC Enhancer (NEB). PCR thermocycling conditions were 98 °C during 5 s ...
-
bioRxiv - Genetics 2022Quote: ... with Klenow fragment (3’-5’ exo-; NEB). Hybridization signals were obtained using Typhoon FLA 7000 (GE Healthcare ...
-
bioRxiv - Microbiology 2022Quote: ... m7G(5’)G RNA Cap Analog (NEB) or Anti-Reverse Cap Analogue (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 U M-MuLV RT (NEB) in RT Buffer (25 mM KCl ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 5 U of Exonuclease I (ExoI, NEB) were added to the PCR mix and incubated at 37 °C for 30 minutes ...
-
bioRxiv - Genetics 2021Quote: ... and 5 μl Murine RNase Inhibitor (NEB). Worm lysate was cleared by centrifugation at 20,000 × g for 20 min at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... To supernatant 5 μl 10x CutSmart (NEB) was added and incubated with 20 units ExoI nuclease (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μL of T4 polynucleotide kinase (NEB), and 25 μL of DEPC H2O and incubating at 25 °C for 30 min ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μL of T4 DNA polymerase (NEB), 1 μL of Klenow DNA polymerase (NEB) ...
-
bioRxiv - Developmental Biology 2019Quote: ... 7.5U Klenow 3’-5’ exo minus (NEB) were incubated for 30 min at 37°C ...
-
bioRxiv - Genetics 2021Quote: ... 5 µl 10X CutSmart buffer (NEB B7204S) and 0.5 µl BbsI or BsaI_HFv2 (the enzyme used for the cloning reaction) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 µl of Gibson assembly mastermix (NEB) and dH2O up to 10 µl were mixed and incubated at 50°C for 1 h ...
-
bioRxiv - Genetics 2020Quote: ... and Antarctic phosphatase (5 U/μl, NEB) in a ratio of 1:10:20 ...
-
bioRxiv - Biochemistry 2022Quote: ... 5% dimethyl sulfoxide (DMSO, New England BioLabs), 0.12% triton X-100 (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2022Quote: ... coli NEB® 5-alpha cells (NEB). Transformed cells were plated on LB agar containing spectinomycin (0.1 g L-1 ...
-
bioRxiv - Neuroscience 2022Quote: ... NEB 5-alpha cells (New England Biolabs) were transformed with pAAV constructs and the integrity of inverted terminal repeats and expression-related elements in selected clones were confirmed by sequencing and restriction digests ...
-
Evolution of protease activation and specificity via alpha-2-macroglobulin-mediated covalent capturebioRxiv - Synthetic Biology 2023Quote: ... 5 µl T4 DNA ligase (both NEB) and 5 µl FastDigest Eco31I (BsaI isoschizomer from ThermoFisher) ...
-
bioRxiv - Microbiology 2023Quote: ... coli NEB 5-alpha (New England Biolabs) was used as a cloning strain ...
-
bioRxiv - Biophysics 2023Quote: ... coli 5-alpha cells (New England BioLabs). Following mutagenesis for fluorescent labeling and/or creating RTT mutations using the Q5 mutagenesis kit (New England BioLabs) ...