Labshake search
Citations for New England Biolabs :
201 - 250 of 2939 citations for 4 Methoxy 6 methyl 6 phenyl 5H pyran 2 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... and then used as the template for an additional 6 cycles of PCR amplification with NEBNext i5 and i7 primers (NEB #E7600S).
-
bioRxiv - Genomics 2021Quote: NGS libraries were generated by amplifying the CUT&Tag DNA fragments with i5 and i7 barcoded HPLC-grade primers (Buenrostro et al., 2015) (Supplementary Table 6) with NEBNext® HiFi 2x PCR Master Mix (New England BioLabs) on a thermocycler with the following program ...
-
bioRxiv - Immunology 2021Quote: ... Reverse transcription reactions were performed with 6 μl of purified RNA and random primers using the NEB ProtoScript II First Strand cDNA Synthesis Kit (NEB, E6560S), according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... 510 ng (6 µl at 85 ng/µl) of DNA was digested using endonucleases EcoRI and MseI (New England BioLabs, Inc.) after which barcoded (EcoRI cut site ...
-
bioRxiv - Molecular Biology 2022Quote: ... Libraries were made with 6 ng of CUT&RUN DNA fragments using the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB #E7645S). The manufacturer’s protocol was adjusted to account for shorter DNA fragments as described previously (33) ...
-
bioRxiv - Cell Biology 2023Quote: ... For second strand cDNA synthesis 6 μL of second strand reaction mix was added [1× NEBNext Second Strand Synthesis buffer (NEB #E6111S), NEBNext Second Strand Synthesis Enzyme Mix ...
-
bioRxiv - Cancer Biology 2023Quote: ... sgRNA barcodes were amplified by PCR using the gDNA from at least 6 mio cells as template and Phusion (NEB M0530) as polymerase ...
-
bioRxiv - Genomics 2022Quote: ... a donor template with the EGFP-stop-codon cassette including a 6 times glycine-alanine spacer sequence was cloned in between the two homology arms by using MluI (NEB: R0198S) and BglII (Roche ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were made with 6 ng of CUT&RUN DNA fragments using the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB #E7645S). The manufacturer’s protocol was adjusted to account for shorter DNA fragments as described previously 45.
-
bioRxiv - Genomics 2023Quote: The purified cDNA was PCR amplified for 6 cycles to generate dsDNA with NEBNext Ultra II Q5 High-Fidelity 2X Master Mix (NEB, M0544) and 0.5 uM PCR primers with unique dual index using the following PCR cycles:
-
High-resolution profiling reveals coupled transcriptional and translational regulation of transgenesbioRxiv - Synthetic Biology 2024Quote: ... cDNA was synthesized from 6 µL of eluted RNA using the ProtoScript First Strand cDNA Synthesis Kit (New England Biolabs, E6300) with oligo-dT primers ...
-
bioRxiv - Plant Biology 2024Quote: ... Site-directed mutagenesis was performed to generate the AeCRKG359E (inactive kinase mutation) and AeRLCK2G110E (rlck2-6 mutant allele mutation) variants using the Q5® Site-Directed Mutagenesis Kit (New England Biolabs). The primers used were AeCRKkin_Mut_G359E_F and AeCRKkin_Mut_G359E_R and the AeRLCK2mutL42F and AeRLCKmutL42R ...
-
bioRxiv - Cancer Biology 2024Quote: Total RNA was collected from parental iOvCa147 cells and DYRK1A-/-cells from 24-hour adherent or 6-hour spheroid conditions using the Monarch Total RNA Miniprep Kit (NEB #T2010S) as described above ...
-
bioRxiv - Neuroscience 2024Quote: ... was added at 1:6 concentration to each sample and the Quick-Load® Purple 100 bp DNA Ladder (#N0551, NEB) was used as a size indicator ...
-
bioRxiv - Molecular Biology 2024Quote: ... Oligo pools were cloned into the vector at a 6:1 molar ratio by Gibson Assembly at 50°C for 30 minutes (NEB E2611). The plasmid pools were ethanol precipitated ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 – 30 µL of cDNA was amplified by 6 to 12 PCR cycles using Illumina indexing primers and Q5 polymerase (New England Biolabs, M0491). For a typical miRXplore miRNA library from 500 ng input ...
-
bioRxiv - Biophysics 2024Quote: The 2N4R isoform of 6×His-tagged human tau protein was cloned into the pRK172 vector and expressed in LEMO21 cells (NEB #C2528J). Cells were cultured in TB media at 37 °C until the OD600 reached 0.6 ...
-
bioRxiv - Developmental Biology 2024Quote: Cells at passage 35-60 were harvested as a single cell suspension using TrypLE Express and 800K cells were nucleofected in 100 μl final volume containing either 2 μg of the Cas9 nickase expression vector 47 with 1 μg of each of the two sgRNAs and 10 μg of the targeting vector (for the INS eGFP allele) or 6 μl Cas9-NLS protein (120 pmol, NEB, M0646M) with 2 μg of each of the sgRNAs (Table S2 ...
-
bioRxiv - Genetics 2024Quote: ... genomic DNA was extracted from approximately 6 million COLO320-DM cells using the Monarch HMW DNA Extraction Kit for Tissue (NEB #T3060L) following the Oxford Nanopore Ultra-Long DNA Sequencing Kit V14 protocol ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Whole-genome data for these latter strains was obtained by extracting genomic DNA from 6 pooled adult aphids using a Monarch® Genomic DNA Purification Kit (New England BioLabs), one pool per strain ...
-
bioRxiv - Biophysics 2020Quote: ... By replacing dCTP with 5-methyl-dCTP (New England BioLabs, Ipswich, MA) in the nucleotide mix ...
-
bioRxiv - Cancer Biology 2021Quote: ... or enzymatic methylation conversion (Enzymatic Methyl-seq Conversion Module, NEB Product #E7125L) to convert unmethylated cytosine to uracil ...
-
bioRxiv - Genomics 2024Quote: DNA was processed using the NEBNext Enzymatic Methyl-seq Kit (NEB, USA) as per the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2020Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-F ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2022Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-Forward ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-Reverse ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Cell Biology 2023Quote: ... one well of cells was sacrificed for direct lysis in 2% SDS blue loading buffer (New England Biolabs) and protein analysis of tau and β-III-tubulin (Sigma T-8660 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 mM MgCl2 and 4 units of RNase Inhibitor Murine (NEB, M0314). After 30 min at room temperature ...
-
bioRxiv - Biochemistry 2020Quote: ... α1- 3,4,6), 10 U β-galactosidase (P0726S, β1-3) and 8 U β-galactosidase (P0746S, β1-3,4) (all from New England BioLabs, USA). All reactions were performed in a final volume of 10 μl in 50 mM sodium acetate buffer ...
-
bioRxiv - Genetics 2020Quote: Genomic DNA from wildtype animals (N2) and from strains bearing the hcp-6(mr17) mutation was amplified using a high-fidelity polymerase (Phusion®, NEB #M0530S) and the following primer pairs:
-
bioRxiv - Molecular Biology 2024Quote: ... The total RNA of 6 samples were used for sequencing with UltraTM RNA Library Prep kit for Illumina® (NEB, MA, USA); all the standards and procedures were performed following the manufacturer’s protocols ...
-
bioRxiv - Genomics 2024Quote: ... the fragmented DNA was treated to attach biotin molecules to its sticky ends by incubating it for 6 h at 37 °C with DNA polymerase I (NEB, Cat.N: M0210) and a mixture of nucleotides containing biotin-14-dATP (Life Technologies ...
-
bioRxiv - Synthetic Biology 2021Quote: ... USA). DNA amplification from a single colony (i.e. colony PCR) was performed with One Taq 2× Master Mix (NEB). Electrocompetent P ...
-
Atypical epigenetic and small RNA control of transposons in clonally reproducing Spirodela polyrhizabioRxiv - Plant Biology 2024Quote: ... Libraries were prepared using the NEBNext® Enzymatic Methyl-seq Kit (NEB, #M7634) following the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Total DNA is then converted with NEBNext Enzymatic Methyl-seq Conversion Module (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: DNA was converted using NEBNext Enzymatic Methyl-seq conversion module (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... Libraries were prepared using the NEBNext® Enzymatic Methyl-seq Kit (NEB, #M7634) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... and NEBNext enzymatic methyl-seq reagents were provided by New England Biolabs (NEB). Genomic DNA isolation and plasmid purifications were performed using Monarch DNA kits (NEB).
-
bioRxiv - Developmental Biology 2024Quote: ... and the NEBNext Multiplex Oligos from Illumina (Index Primers Set 1, 2, 3 and 4, NEB, E7335S, E7500S, E7710S, E7730S), following the manufacturer’s protocols ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Reverse transcription was performed on 10 μL of RNA using the ProtoScript II Reverse Transcriptase and Random Primer 6 (New England BioLabs, Ipswich, MA, USA) under the following thermal conditions ...
-
bioRxiv - Genomics 2023Quote: ... and chromatin was digested during 10 min at 37 °C with 6 Kunitz units of MNase (New England Biolabs, 200 Kunitz units/µl) per 1 million cells ...
-
bioRxiv - Genomics 2023Quote: ... 2-8 µg of HMW DNA was diluted in 1x CutSmart Buffer and 6 µl of Quick CIP enzyme (New England Biolabs, catalog no. M0508) was added followed by incubation of the reaction at 37°C for 30 minutes ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.1 µM of the 6-kb fragment was incubated with 1 unit/µL terminal deoxynucleotidyl transferase (TdT, New England Biolabs, MA, USA, #M0315S) and 0.5 mM deoxyadenosine triphosphate (dATP ...
-
bioRxiv - Genetics 2024Quote: ... followed by a 10-fold dilution of the universal adaptor and 6 cycles of PCR with the NEBNext Ultra II FS DNA Library Prep Kit for Illumina (NEB, Cat. No. E7805S), and the NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs ...
-
bioRxiv - Microbiology 2020Quote: Reverse transcription and amplification for figure 2 was performed using OneTaq One-Step RT-PCR Kit from NEB (cat. # E5315S). Both the OneTaq One-Step RT-PCR Kit and Luna Universal One-step RT-qPCR Kit (cat ...
-
bioRxiv - Plant Biology 2021Quote: ... One μl of each 100 μM oligo was added to 500 μl 1x NEB buffer 2 (New England Biolabs, www.neb.com). The p201N:Cas9 plasmid was linearized by digestion with Spe1 (www.neb.com ...
-
bioRxiv - Microbiology 2024Quote: Quantification of SARS-CoV-2 E gene subgenomic mRNA (sgmRNA) was conducted using Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) on a Step One Plus Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Microbiology 2024Quote: ... the RNA pellet was resuspended in 50 µl of RNase-free H2O and 1 µl of the resuspended samples was used for quantification of the DENV-2 D220 NS5 RNA regions using Luna Universal One-Step RT-qPCR Kit (New England Biolabs) in a 10-ul reaction volume ...
-
bioRxiv - Plant Biology 2024Quote: ... To obtain CRISPR-Cas9 mutant alleles of RELK1 one guide RNA specific for exon 2 was cloned into pBUE411 by HiFi cloning (NEB). The resulting construct was introduced into Hi-II immature embryos by Agrobacterium-mediated transformation ...
-
bioRxiv - Genomics 2021Quote: ... One μL APOBEC3A (NEB #E7120S) was added directly to the reaction with 10 μL of 10x APOBEC3A reaction buffer and 1 μL BSA (10 mg/mL) ...