Labshake search
Citations for New England Biolabs :
201 - 250 of 6319 citations for 4' Trifluoromethoxy 5 trifluoromethyl 1 1' biphenyl 3 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... and A-tailed using Klenow (3′-5′ exo-; New England Biolabs). Illumina sequencing adapters were then ligated to DNA ends using Quick Ligase (New England Biolabs) ...
-
bioRxiv - Genomics 2020Quote: ... EcoRI-HF (5’ GAATTC 3’) (New England BioLabs Inc., Ipswich, MA). gDNA samples that showed poor banding patterns or could not be digested by the enzymes listed above were then digested with Taq⍺I (5’ TCGA 3’ ...
-
bioRxiv - Genomics 2022Quote: ... and 2 μl of Klenow Fragment (3’→5’ exo-) (M0212L, NEB). The reactions were incubated at 37ºC for 30 minutes and then cleaned up with a Clean and Concentrate-25 column (Zymo) ...
-
bioRxiv - Genomics 2023Quote: ... and 2.5 U Klenow Fragment (3’ -> 5’ exo-) (New England BioLabs) and H2O to 20 μL ...
-
bioRxiv - Systems Biology 2024Quote: ... and A-tailed using Klenow HC 3′ → 5′ exo (#M0212L; NEB).
-
bioRxiv - Microbiology 2024Quote: ... MBTUni-13 primer (5’-ACGCGTGATCAGTAGAAACAAGG-3’) and Phusion Polymerase (NEB M0530L). PCR products were purified with PureLink PCR Purification Kit (Invitrogen K310002 ...
-
bioRxiv - Molecular Biology 2024Quote: ... dA-tailing was done using Klenow fragment (3′→5′ exo-, NEB) with deoxyadenosine triphosphate (dATP ...
-
bioRxiv - Molecular Biology 2020Quote: ... was linked to the free hydroxyl group at the 3’-end of transcripts (1 □g of total RNA) by T4 RNA ligase 1 (NEB M0204) in the presence of 15% (w/v ...
-
bioRxiv - Genomics 2021Quote: ... and 4 μl 5 U/μL I-SceI (NEB, #R0694L) in a 50 μL final volume for 3 hours at 37°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 µl of 10x RNase H reaction buffer and 1 µl (5 units) of RNase H (New England Biolabs) were added to 8 µl of the reaction mixture and incubation was continued for another 30 min ...
-
bioRxiv - Neuroscience 2022Quote: 4 µl procainamide-labeled glycans were combined with 1 µl 10x sodium acetate – Ca2+ buffer (Glycobuffer 1, New England Biolabs), 1 µl 10x BSA (diluted 1:10 with Milli-Q water from a 100X stock ...
-
bioRxiv - Microbiology 2023Quote: Verified amplicons were combined with the pMV306H integrative vector backbone at a ratio of 1:1 v/v and allowed to ligate overnight at 4°C with T4 DNA ligase (NEB). Ligation products were subsequently transformed into chemically competent DH5ɑ E.coli ...
-
bioRxiv - Neuroscience 2023Quote: ... a 3′ RNA adapter with a phosphate on its 5’ (5’- /5Phos/r(N:25252525)r(N:25252525)r(N:25252525)rUrGrGrArArUrUrCrUrCrGrGrGrUrGrCrC rArArGrG/3SpC3/-3’) end was ligated to RNA 3’ ends using T4 RNA ligase 1 (NEB, M0437) at 25 °C for 75 min (with gentle agitation every 10 min) ...
-
bioRxiv - Immunology 2021Quote: ... Step 3 was cloned into Step 4 with T4 DNA ligase (NEB) and then this recominbeering fragment (5’ arm of homology ...
-
bioRxiv - Genomics 2021Quote: ... augments Cap-specific 5’ adapter ligation by T4 RNA ligase 1(NEB). The 3’ adapter was ligated using truncated T4 RNA ligase 2 (NEB ...
-
bioRxiv - Systems Biology 2021Quote: ... Beads were resuspended at 5 µg µl-1 followed by MseI (NEB) digestion according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... augments Cap-specific 5’ adapter ligation by T4 RNA ligase 1 (NEB)(Hetzel et al. ...
-
bioRxiv - Microbiology 2021Quote: ... T5 exonuclease diluted 1:5 with 5X reaction buffer (New England BioLabs) (0.01 units/μL) ...
-
bioRxiv - Genetics 2020Quote: ... Only 1 U/μl I-SceI enzyme 5 X/μl buffer (NEB) were mixed when co-injecting with the HDR donor ...
-
bioRxiv - Microbiology 2021Quote: ... T5 exonuclease diluted 1:5 with 5X reaction buffer (New England BioLabs) (0.01 units/µL) ...
-
bioRxiv - Genomics 2021Quote: ... 5′ adapter ligation with T4 RNA Ligase 1 (NEB, Ipswich, MA; M0204). The 5’ adaptor contained a 6-nucleotide unique molecular identifier (UMI ...
-
bioRxiv - Genomics 2022Quote: ... 5′ adapter ligation with T4 RNA Ligase 1 (NEB, Ipswich, MA; M0204). The 5’ adaptor contained a 6-nucleotide unique molecular identifier (UMI ...
-
bioRxiv - Microbiology 2022Quote: ... T5 exonuclease diluted 1:5 with 5X reaction buffer (New England BioLabs) (0.01 units/µL) ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were pretreated with homemade PIR-1 or 5’ Pyrophosphohydrolase (RppH, NEB). The small RNAs were then ligated to a 3’ adaptor (5’ rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’ ...
-
bioRxiv - Genetics 2023Quote: ... 2 μL 1 M CaCl2 and 5 μL micrococcal nuclease (NEB, #M0247S) were added and chromatin was fragmented into predominantly mono-nucleosomes by incubation at 37°C for 15 min ...
-
bioRxiv - Microbiology 2023Quote: ... T5 exonuclease diluted 1:5 with 5X reaction buffer (New England BioLabs) (0.01 units/μL) ...
-
bioRxiv - Genomics 2023Quote: ... and 1 µL of Taq Polymerase (5 U/µL, New England Biolabs) to the CIP reaction ...
-
bioRxiv - Genomics 2024Quote: ... 1 U of Hot Start Taq DNA Polymerase (5 U/μL, NEB), 1X PCR buffer ...
-
bioRxiv - Genomics 2020Quote: ... and followed by incubation with 3 μl (1 U/μl) of USER enzyme (NEB) at 37°C for 20 min ...
-
bioRxiv - Plant Biology 2021Quote: ... and ligated at a 3:1 amplicon:plasmid ratio with t4 DNA ligase (NEB, US) overnight at 16°C ...
-
bioRxiv - Genetics 2020Quote: ... remaining ssDNA oligonucleotides were digested by the addition of 3 μL exonuclease 1 (NEB) to 20 μL extracted DNA ...
-
bioRxiv - Plant Biology 2024Quote: ... was used for Level 1 and 3 assembly and SapI (New England BioLabs, USA) for Level 2 assembly ...
-
bioRxiv - Molecular Biology 2023Quote: ... these products were ligated to a 3’ adapter (1× T4 RNA ligase buffer (NEB), 10% PEG-8000 ...
-
bioRxiv - Cell Biology 2024Quote: ... infrared IR800-dye conjugated 3’ adapters were ligated overnight using RNA ligase 1 (NEB) in a high-percentage PEG8000 buffer ...
-
bioRxiv - Genomics 2024Quote: ... 264 nl of 3’ ligation brew (1× T4 RNA Ligase Buffer (New England Biolabs), 1 µM pre-adenylated 3’ linker (Integrated DNA Technologies) ...
-
bioRxiv - Bioengineering 2023Quote: ... 4 ng gBlock template and 1 Unit Phusion High-Fidelity DNA polymerase (NEB). The reaction was subjected to a 2-minute initial denaturation at 98 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... 250 μL of 2 mg mL-1 Y289L GalT,46 50 μL of 500 kU mL-1 PNGase F (New England Biolabs, 5 U μg-1 of protein), and 62.5 μL of Lambda Protein Phosphatase (New England Biolabs ...
-
bioRxiv - Neuroscience 2020Quote: ... + 5 % non-fat milk for 1 hour at room temperature before incubating with primary antibody: anti-GFP (1:1000, Biolabs) or anti-actin (1:5000 ...
-
bioRxiv - Microbiology 2023Quote: ... The membrane was washed three times in TBS-T for 5 min each before incubation for 1 h with secondary antibody (anti-rabbit IgG HRP, 1:5000 dilution, 7074S, NEB) in TBS-T with 1% (w/v ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA (400ng) was then ligated the 3’adaptor (5’-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3’) using T4 RNA ligase 2(NEB) for 4 h at 37°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Adenosine was added to the 3’ end of the DNA fragments using Klenow (3’-5’ exo-) (New England Biolabs). DNA was purified using ratio of 1:1.8 sample to AMPure XP beads ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA (400ng) was then ligated the 3′adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′) using T4 RNA ligase 2 (NEB) for 4 h at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... Adenosine was added to the 3’ end of the DNA fragments using Klenow (3’-5’ exo-) (New England Biolabs). DNA was purified using ratio of 1:1.8 sample to AMPure XP beads ...
-
bioRxiv - Microbiology 2021Quote: ... and a total of 20 μg were ligated with 50 pmol 3′adaptor Linker (5′-rAppCTGTAGGCACCATCAAT–NH2-3′; NEB) via a 16 h incubation at 16°C using 20 U T4 RNA ligase (Ambion) ...
-
bioRxiv - Plant Biology 2021Quote: ... and cloned into Gateway™ pENTR™ 4 by mixing the linearized vector backbone and PCR product in a 1:1 ratio using Gibson assembly (NEB), before transformation into DH10B electro-competent E ...
-
bioRxiv - Molecular Biology 2020Quote: ... 8 μl 5x PNK pH 6.5 buffer [350 mM Tris-HCl pH 6.5, 50 mM MgCl2, 5 mM DTT], 1 μl PNK enzyme [NEB] ...
-
bioRxiv - Genomics 2020Quote: ... and SalI (5’-GTCGAC-3’, New England Biolabs Inc., MA, CA#R3138S) restriction enzymes ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and A-tailed using Klenow (3′-5′ exo-; New England Biolabs M0212L). Illumina-compatible adapters were subsequently ligated to DNA ends ...
-
bioRxiv - Genomics 2021Quote: ... and A-tailed using Klenow Fragment (3’→5’ exo-) (New England Biolabs) followed by the ligation of NEXTFLEX® Bisulfite-Seq adapters ...
-
bioRxiv - Molecular Biology 2020Quote: ... A mix of 5 μl 3’Ligation Reaction Buffer 2x (NEB-kit) and 1.5 μl of 3’Ligation Enzyme Mix (NEB-kit ...