Labshake search
Citations for New England Biolabs :
201 - 250 of 4372 citations for 3 1 Phenylethylamino propane 1 thiol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... 1 mM ATP (NEB), 1×T4 DNA Ligase Buffer and 800 U T4 DNA ligase (NEB) ...
-
bioRxiv - Microbiology 2022Quote: ... 1× Buffer 2.1 (NEB), 2 µg BSA and 3 units of T4 DNA polymerase (NEB ...
-
bioRxiv - Biochemistry 2021Quote: ... coli Topoisomerase 1 (NEB), 0.1 mg/ml BSA ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 µl MlyI (NEB). The digest was incubated at 37°C for 1 hour ...
-
bioRxiv - Genomics 2021Quote: ... 1 mM NAD+ (NEB) and water to a volume of 20 μl ...
-
bioRxiv - Genomics 2022Quote: ... 1 mM dNTPs (NEB), 1 U/μL RNase Inhibitor (NxGen ...
-
bioRxiv - Molecular Biology 2023Quote: ... pyogenes (1 μl, NEB), and 0.2 µl phenol red were mixed in an Eppendorf tube (total volume 2.2 μl ...
-
bioRxiv - Molecular Biology 2023Quote: ... after DNase 1 (NEB) treatment.
-
bioRxiv - Microbiology 2024Quote: ... 1 mM NAD+ (NEB), 4 µg of DNA or RNA oligo ...
-
bioRxiv - Genomics 2024Quote: ... 1% BSA (NEB, B9000S), and 1U/ml Protector RNase Inhibitor (between 100-200 μl depending on pellet volume) ...
-
bioRxiv - Genomics 2023Quote: ... 1 mM ATP (NEB), 4 mM DTT (Promega) ...
-
bioRxiv - Genomics 2022Quote: ... 1 μl RNaseOut (NEB), 2 μl of 100 μM TSO ...
-
bioRxiv - Microbiology 2023Quote: ... 1 µl DpnI (NEB) was added to the PCR mix ...
-
bioRxiv - Genomics 2023Quote: ... and 1× Thermopol (NEB) at 72°C for 60 min ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 1 µl ExoI (NEB) and incubated for 1 h at 37°C followed by heat inactivation of 20 min at 80°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... Apyrase (1-unit, NEB) was then added ...
-
bioRxiv - Molecular Biology 2024Quote: ... Apyrase (1 unit, NEB) was added for an additional 1.5 hours ...
-
bioRxiv - Molecular Biology 2024Quote: ... apyrase (1 unit NEB) was added for an additional 1.5 hours ...
-
bioRxiv - Molecular Biology 2024Quote: ... with GlycoBuffer 1 (NEB) was added.
-
bioRxiv - Genomics 2024Quote: ... 1 μL NAD+ (NEB), 1 μL dNTP mix (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the manufacturer’s protocol or with radioactive labeling mix (1 µL 10x PNK buffer, NEB, 1 µL of 100 µM gapmer, 1 µL T4 PNK, NEB, 1 µL γ-32P-ATP, Hartmann, 6 µL ddH2O) for 40 min at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μl 10 pM/μl TrAEL-seq adaptor 1 (49) and 1 μl T4 RNA ligase 2 truncated KQ (NEB M0373L). Plugs were then rinsed with 1 ml tris buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 μL of Disulfide Bond Enhancer 1 and 1 μL of Disulfide Bond Enhancer 2 (New England Biolabs Cat No. E6820S). The reactions were incubated at 37 °C for 8 hours and used immediately or stored at -80 °C ...
-
bioRxiv - Physiology 2024Quote: ... 5 flies were sorted into sterile microcentrifuge tubes and homogenised in 200 µl lysis buffer (1 X TE, 1 % Triton X-100, 1/100 proteinase K (NEB, P8107S)) using a mechanical pestle ...
-
bioRxiv - Bioengineering 2024Quote: ... and phosphorylated (1 μL 100 μM F oligo, 1 μL 100 μM R oligo, 1 μL T4 ligase buffer (NEB, B0202S), 1 μL T4 PNK (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... with a 1:1 combination of oligodT 18 primers and random hexamers (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μl 10× T4 PNK buffer and 1 μl T4 PNK enzyme (NEB) at 37 °C for 30 min ...
-
bioRxiv - Bioengineering 2022Quote: ... 120 nM fluorescent beacon and 1 U.μL-1 murine RNase Inhibitor (NEB M0314) in the reaction buffer containing 50 mM Tris-HCl (pH 7.5) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 μl of BsaI-HFv2 and 1 μl of T4 DNA ligase (NEB).
-
bioRxiv - Molecular Biology 2023Quote: ... RNase H diluted (1:100) in 1× RNase H buffer (New England Biolabs) was added to the cells and incubated for 2 h at 37°C ...
-
bioRxiv - Microbiology 2024Quote: ... The reaction was further adjusted with dTTP (1 µl, 1 mM) (NEB #N0443S), TdT reaction buffer (1 µl) ...
-
bioRxiv - Microbiology 2024Quote: ... 1 μl of DNAse I at 1 mg/ml (NEB, cat no. M0303L), 1 μl RNAse at 10mg/ml (NEB ...
-
bioRxiv - Biophysics 2024Quote: ... a 1 μL portion of a 1 mg/mL stock of trypsin (NEB Trypsin-ultraTM ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... the resulting cell pellet was resuspended in 1 mL of RNA Protection Buffer (1× NEB DNA/RNA Protection Reagent, 1% (w/v) polyvinylpyrrolidone-40 ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Biochemistry 2022Quote: ... purified KRAS protein was mixed with GMP-PNP (molar ratio of 10:1 GMP-PNP:KRAS) and calf intestinal alkaline phosphatase (NEB cat# M0290, 3 units per mg of KRAS). The reaction mixture was incubated for 3 hours at room temperature and then purified by size-exclusion chromatography on a 10/300 Superdex 75 GL column (GE Healthcare ...
-
bioRxiv - Microbiology 2020Quote: ... 3 mM MgCl2 (NEB), 0.24 mg.ml−1 BSA (Fermentas) ...
-
bioRxiv - Neuroscience 2021Quote: ... and 3 (NEB #E7710) were used to create unique identifiers for each cDNA library sample ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3 µL MNase (NEB) was added to a clarified K562 lysate from ∼5 M cells and digested for 30 minutes at 37 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3’ NotI (NEB) before being tested by sequencing (Macrogen ...
-
bioRxiv - Genomics 2023Quote: ... and incubated at 37°C for 1 hour with RNase A/T1 (Thermo, 1/20 volume) and RNase H (NEB, 1/50 volume). The DNA was then purified again.
-
bioRxiv - Neuroscience 2021Quote: ... 1 μL cDNA was amplified using 1 μL Phusion High-Fidelity DNA Polymerase (NEB) in HF Phusion buffer with 10 μM primers ...
-
bioRxiv - Plant Biology 2021Quote: ... 1 μL Bacillus stearothermophilus (Bst) DNA polymerase (8 U μl-1) (New England Biolabs), 2 μL DNA template ...
-
bioRxiv - Molecular Biology 2020Quote: ... amplicons were visualized on ~1% agarose gels with 1 kb plus DNA ladder (NEB) and SYBR Gold (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... and 1 μl of High Concentration T4 RNA Ligase 1 (New England BioLabs, M0437)] at 23°C for 5 h ...
-
bioRxiv - Microbiology 2023Quote: ... lysates (1 mg) were incubated with MNase (10 units/1 mg lysate; NEB #M0247S) at 37°C for 60 min ...
-
bioRxiv - Genetics 2023Quote: ... containing 1× Exonuclease I Buffer and 1 U/µL Exonuclease I (NEB, cat # B0293S), and incubated at 37 °C for 45 min ...
-
bioRxiv - Microbiology 2024Quote: ... the product was incubated with 1 μl of dTTP (1 mM, NEB Catalog # N443S), 1 μL of Tdt buffer ...
-
bioRxiv - Microbiology 2024Quote: ... the product was incubated with 1 μL of dTTP (1 mM, NEB Catalog # N)443S) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’-hydroxyl (5’HO-RNA30-FAM-3’) or 5’-Gppp (5’Gppp-RNA30-FAM-3’) in 1x NEBuffer 3 (NEB; B7003), in 20% denaturing polyacrylamide gels ...