Labshake search
Citations for New England Biolabs :
201 - 250 of 10000+ citations for 2 Arachidonoylglycerol 2 AG CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-F ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2022Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-Forward ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-Reverse ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2022Quote: ... poly(A) RNA (2-5 ng) was converted to cDNA using the Protoscript II kit (New England Biolabs) and a supplied mix of random hexamer and d(T)23VN primers ...
-
bioRxiv - Plant Biology 2023Quote: ... cDNA was synthesized on 2 µg of total RNA using ProtoScript II First Strand cDNA Synthesis Kit (NEB) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... 41.7 µL of Phusion 2× Master Mix (NEB), 2.5 µL of 10 µM primer mix (515F forward and 806R reverse rRNA gene V4 primers with Illumina MiSeq adaptors) ...
-
bioRxiv - Genomics 2019Quote: ... 10 μl NEB Buffer 2 (New England Biolabs), 12 μl dNTP mix (2.5 mM) ...
-
bioRxiv - Cell Biology 2019Quote: ... 2 mM ribonucleoside vanadyl complex (RVC) (NEB, S1402), 0.02% RNase-free BSA (Ambion ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... treated with 2 units of DNase I (NEB) at 37°C for 1 hour followed by DNase I heat inactivation ...
-
bioRxiv - Genomics 2020Quote: ... 2 μl Antarctic Phosphatase [5k U/mL] (NEB) and 1 μl RNase inhibitor and incubating at 37 °C for 30 minutes with shaking ...
-
bioRxiv - Genomics 2021Quote: ... 10 µL of 2% BSA (New England Biolabs), 930 µL of nuclease-free water and supplemented with 0.2 U/ul RNaseIN Plus (Promega ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 µl RNase Inhibitor (80U final, NEB M0307L) and 2 µl SuperScript III (400U final ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 µl RNase Inhibitor (80U final, NEB M0307L) and 1 µl AMV RT (12U final ...
-
bioRxiv - Genetics 2021Quote: ... viewpoint 2: 10X NEBuffer™ DpnII (R0543M, NEB)) and 15 μl of 10% SDS buffer were added to the 450 μl sample ...
-
Insights into the secondary structural ensembles of the full SARS-CoV-2 RNA genome in infected cellsbioRxiv - Biochemistry 2021Quote: ... 2 μl 10x CutSmart buffer (New England Biolabs), 10 μl shrimp alkaline phosphatase (New England Biolabs) ...
-
bioRxiv - Microbiology 2021Quote: ... 2 μl 10× T4 RNA ligase buffer (NEB), 20 U T4 RNA ligase enzyme ...
-
bioRxiv - Microbiology 2021Quote: ... 2 μl of 10× Antarctic Phosphatase buffer (NEB), 1 U Antarctic Phosphatase ...
-
bioRxiv - Neuroscience 2022Quote: ... and 2 µl T4 ligase (NEB cat #M0202M). For Capture-C ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 2 μl T4 Ligase Buffer (NEB, B0202) in a total volume of 30 μl for 18 hours at 16 °C ...
-
bioRxiv - Immunology 2022Quote: ... dNTP mix (2 mM each) (New England Biolabs), 50U Superscript III RTase ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 units of T4 polynucleotide kinase (NEB, M0201S), 0.09 nM dNTPs and 0.045 μg/μL of BSA at 12°C for 30 min ...
-
bioRxiv - Plant Biology 2021Quote: ... M-TM2^2 was digested with BslI (NEB) for 3 hours at 55°C and M-2 was digested with XhoI (NEB ...
-
bioRxiv - Biophysics 2021Quote: ... 2 nM M13mp18 circular ssDNA (New England Biolabs) (Table S3 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... added Cut smart (2 ul, Cat # B7204; NEB), Bsa I (2ul ...
-
bioRxiv - Microbiology 2022Quote: ... 2 μl of RNaseH (10 U, NEB, M0297) was added followed by an incubation of 20 minutes at 37°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 μl 10x NEBuffer 1 (New England Biolabs), 2 μl 50 mM MnCl2 ...
-
bioRxiv - Microbiology 2021Quote: ... and Vaccinia 2’-O-methyltransferase (New England Biolabs). The mRNA was purified by oligo-dT affinity purification ...
-
bioRxiv - Neuroscience 2021Quote: ... 2) proteinase K digestion (New England Biolabs P8107S) at 37°C for 18 hrs ...
-
bioRxiv - Microbiology 2021Quote: ... 2 μl murine RNase inhibitor (New England Biolabs) in nuclease assay buffer (40 mM Tris-HCl ...
-
bioRxiv - Microbiology 2021Quote: ... 2 μl murine RNase inhibitor (New England Biolabs) in nuclease assay buffer (40 mM Tris-HCl ...
-
bioRxiv - Neuroscience 2020Quote: ... 2 μL PNGase F (500U/μL) (NEB # P0704) was added to the elution buffer and the samples were incubated for 3 h at 37 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 2 U/μL murine RNase inhibitor (NEB) in nuclease-free water (HyClone) ...
-
bioRxiv - Immunology 2022Quote: ... and Vaccinia 2’ O-methyltransferase (New England Biolabs). The mRNA was purified utilizing oligo-dT affinity chromatography and encapsulated in an LNP through a modified ethanol-drop nanoprecipitation process ...
-
bioRxiv - Microbiology 2022Quote: ... mixed with 2× agarose gel loading dye (NEB), and resolved on 1% ultrapure agarose gel (Invitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... mixed with 2× agarose gel loading dye (NEB), and resolved on 1% ultrapure agarose gel (Invitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... 2 µL Thermostable RNase H (NEB, CN E7850), and 1 µL nuclease-free H2O ...
-
bioRxiv - Genomics 2022Quote: ... and 10 uL 2% BSA (New England Biolabs) for sample resuspension and dilution prior to 10x Genomics chip loading ...
-
bioRxiv - Genomics 2022Quote: ... 10 μL of 2% BSA (New England Biolabs), and 984 μL of nuclease-free water 1xST buffer was prepared by diluting 2x ST with ultrapure water (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µL LongAmp Taq DNA Polymerase (NEB, # M0323L), 0.5 µM of each primer (First PCR F ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µL LongAmp Taq DNA Polymerase (NEB, # M0323L), 0.5 µM of each primer (Second PCR F UMI ...
-
bioRxiv - Microbiology 2023Quote: ... 2 µM PNA,1X KAPA master mix (NEB) and 50 ng of template DNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 µL 10X NEB Buffer #2 (NEB #B7002S), 5 µL RppH (NEB #M0356S) ...
-
bioRxiv - Biochemistry 2023Quote: ... 2 μl Taq DNA ligase (80 U, NEB), and 1 μl T4 DNA Polymerase (1 U ...
-
bioRxiv - Biochemistry 2023Quote: ... 2 μl 10x Taq DNA Ligase buffer (NEB), 2 uL dNTP Solution Mix (10 mM stock ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 U of beta-agarose I (NEB, M0392), and 5 μL of Maxima H minus reverse transcriptase ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 uL of T4 RNA Ligase Buffer (NEB) and 1 uL T4 RNA Ligase 2 (made in-house ...
-
bioRxiv - Systems Biology 2023Quote: ... The mix contains 1x NEBuffer-2 (NEB, #B7002S), 10 µM of Randomer (custom DNA oligo ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 units of T4 polynucleotide kinase (NEB, M0201S), 0.09 nM dNTPs and 0.045 μg/μL of BSA at 12°C for 30 min ...
-
Cas13d-mediated isoform-specific RNA knockdown with a unified computational and experimental toolboxbioRxiv - Genomics 2023Quote: ... 10 µl 2× Gibson Assembly Master Mix (NEB)) ...
-
bioRxiv - Bioengineering 2023Quote: ... and mRNA Cap 2’-O-methyltransferase (NEB, M0366S). Then ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 µL of Lambda Protein Phosphatase (NEB, P0753S) was added to aliquots 3 and 4 (PPase only) ...