Labshake search
Citations for New England Biolabs :
2401 - 2450 of 10000+ citations for Rat Stress Induced Phosphoprotein 1 STIP1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2019Quote: ... The embryos were treated with protease (1 µL of 25 µg/µL Qiagen Protease, 1 µL of 10x NEB Buffer 4 ...
-
bioRxiv - Genomics 2020Quote: ... 50 ng of DNA was incubated for 1 hour at 60 °C with 1 U BstUI and 0.5 uL 10x CutSmart buffer (New England Biolabs), in a total volume of 5.0 uL ...
-
bioRxiv - Biochemistry 2022Quote: ... Cleavage fragments were resolved by 0.8% agarose gel electrophoresis with 1 μL of 1 kb Plus DNA Ladder (NEB) and visualized by ethidium bromide staining ...
-
bioRxiv - Biochemistry 2021Quote: ... samples were incubated for 1 h at 37°C with 1 µl Endo H in GlycoBuffer 3 (NEB P0702S) after denaturing in SDS sample buffer prior to running SDS-PAGE.
-
bioRxiv - Microbiology 2020Quote: ... Beads were resuspended in 48 μL elution buffer (50 mM Tris pH 8, 1 mM EDTA, 1% SDS) and 1.6 U Proteinase K (NEB), incubated at 55 °C for one hour and then 65 °C overnight ...
-
bioRxiv - Biophysics 2019Quote: ... Supplementary Table 1) was digested in 200 µl of 1 × CutSmart buffer using 100 units of BsaI-HF (NEB) and 100 units of DraIII-HF (NEB ...
-
Structure-guided glyco-engineering of ACE2 for improved potency as soluble SARS-CoV-2 decoy receptorbioRxiv - Biochemistry 2021Quote: ... proteins (2 mg mL-1) were incubated with 180000 U mL-1 PNGase F (New England Biolabs, Unites States) in PBS (pH 7.4 ...
-
bioRxiv - Microbiology 2021Quote: ... Chromosomal DNA (1 µg) was digested with 10 units (1 µl) of restriction enzyme AciI (New England Biolabs (NEB)) for one hour at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... Chromosomal DNA (1 µg) was digested with 10 units (1 µl) of restriction enzyme AciI (New England Biolabs (NEB)) for one hour at 37°C ...
-
bioRxiv - Bioengineering 2022Quote: ... 1 µL of 1 µM Cas9 Nuclease (diluted from 20 µM stock in 1X NEBuffer r3.1) (NEB; catalog # M0386T), and 1X NEBuffer 3.1 (NEB ...
-
bioRxiv - Genetics 2023Quote: ... 12% PEG-8000, 1 mM dNTPs, 1 μM second strand synthesis primer (AAGCAGTGGTATCAACGCAGAGTGAATG, Sangon) and 0.125 U/μL Klenow exo- (BioLabs)) at 37 °C for 1 h with rotation ...
-
bioRxiv - Microbiology 2023Quote: ... while the ter region was amplified using the primer pair 3778_ter 1 qPCR fwd with 3778_ter 1 qPCR rev and the Luna Universal qPCR Master Mix (New England Biolabs). Quantification of the ori/ter ratio was performed using the the 2-ΔCT method as described [62].
-
bioRxiv - Molecular Biology 2023Quote: ... in a 10 μL reaction in buffer (50 mM Tris-HCl pH 7.5, 1 mM DTT, 1 U/μL RNase Inhibitor (NEB)) and incubated for 1 hour at 37°C ...
-
bioRxiv - Plant Biology 2023Quote: ... The PCR products were inserted into pET28a using restriction digestion and ligation with EcoR 1 and Sal 1 (NEB) sites.
-
bioRxiv - Microbiology 2023Quote: ... This digestion was performed on 1-3 µg of the PCR2 product with 1 µL of exonuclease (NEB #M0262) at 37°C for 30 min before heat inactivation ...
-
bioRxiv - Plant Biology 2023Quote: ... The precipitates were eluted into 30μL 1×SDS loading buffer and detected using anti-Myc and anti-MBP antibody (1:5,000, New England Biolabs).
-
bioRxiv - Bioengineering 2024Quote: ... were mixed in molar ratio 1:1 and 0.37 pmol of total DNA was then treated by Gibson Assembly Master Mix (New England Biolabs) for 3 hours at 50°C ...
-
bioRxiv - Microbiology 2020Quote: ... total RNA was collected and prepared using Monarch Total RNA Miniprep Kits (NEB). For SARS-CoV-2 experiments ...
-
bioRxiv - Plant Biology 2020Quote: ... followed by subcloning into pEAQ-HT vector using the Gibson assembly kit (NEB). Linearization of pEAQ-HT vector was performed by XhoI and AgeI restriction enzyme double digestion ...
-
bioRxiv - Plant Biology 2019Quote: ... The libraries were prepared using the Next Ultra RNA Library Prep Kit (NEB) by the company Novogene (China) ...
-
bioRxiv - Microbiology 2020Quote: ... chloramphenicol or apramycin resistance cassette by using the Gibson isothermal assembly kit (NEB) followed by PCR amplification using the primers from the extremities ...
-
bioRxiv - Microbiology 2020Quote: ... followed by vector-insert ligation using the Quick Ligation kit (New England Biolabs) to generate the original and mutated pCAGGS-HHRz-3M-eGFP-5M vectors ...
-
bioRxiv - Cell Biology 2019Quote: ... rRNA was depleted using the NEBNext rRNA Depletion Kit (E6310, New England Biolabs) and subsequently directional RNA-seq libraries were prepared using the NEBNext Ultra Directional RNA Library Prep Kit for Illumina (E7420 ...
-
bioRxiv - Immunology 2021Quote: ... The released DNA was cleaned up using Monarch DNA PCR Clean Kit (NEB) and eluted in TE buffer ...
-
bioRxiv - Genetics 2021Quote: SpyCas9 tyr and tbxta sgRNAs were synthesized using EnGen sgRNA Synthesis Kit (NEB). SauCas9 ...
-
bioRxiv - Developmental Biology 2021Quote: ... The amplicon was purified using the Monarch PCR and DNA Cleanup Kit (NEB), and 1 ug used as template for transcription of digoxigenin labelled riboprobes using the DIG RNA Labelling mix (Sigma).
-
bioRxiv - Genetics 2021Quote: ... The NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs) was used for library preparation ...
-
bioRxiv - Microbiology 2019Quote: ... and quantified using a NEBNext Library Quant kit for Illumina (New England BioLabs). Pooled libraries were then sequenced on a MiSeq platform (Illumina ...
-
bioRxiv - Molecular Biology 2021Quote: ... rad27 mutant alleles were constructed with the Q5 mutagenesis kit (New England Biolabs) using pEAA720 as template The oligonucleotides used to make the alleles are shown in Table S7) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... DNA libraries were constructed using NEBNext DNA Library Prep Kits (New England Biolabs). Samples were processed and sequenced at Novogene (Hong Kong ...
-
bioRxiv - Developmental Biology 2020Quote: cDNA was synthesized using the ProtoScriptII First Strand cDNA synthesis kit (NEB E6560S). Cloning of the full length admats9 from pooled cDNA from 3 ...
-
bioRxiv - Developmental Biology 2021Quote: ... They generated mRNA libraries with NEB RNA Ultra kit (New England Biolabs E7770L) and dToligos probe were used to target mRNA for cDNA synthesis ...
-
bioRxiv - Bioengineering 2022Quote: ... Amplicons were then indexed using the NEBNext Multiplex Oligos for Illumina kit (NEB). Amplicons were then pooled and sequenced using a Miseq Nano with paired end 150 bp reads ...
-
bioRxiv - Molecular Biology 2020Quote: ... by using NEBuilder® HiFi DNA Assembly Cloning Kit (New England Biolabs, E5520S).
-
bioRxiv - Molecular Biology 2021Quote: ... The next day samples were purified using PCR cleanup kit columns (Monarch, NEB) and eluted using 50 μl kit elution buffer.
-
bioRxiv - Molecular Biology 2021Quote: ... Libraries were prepared using NEBnext Ultra DNA library prep kit for Illumina (NEB). Samples were paired-end sequenced at the iGE3 genomics platform of the University of Geneva.
-
bioRxiv - Molecular Biology 2021Quote: ... Illumina libraries were constructed using the NEBNext Ultra II kit (New England Biolabs) and sequenced on an Illumina HiSeq2500 ...
-
bioRxiv - Cell Biology 2022Quote: ... and adapter ligation were performed by using RNA library prep kit (E7530L, NEB). DNA products were cleaned using AMPure XP beads (Beckman) ...
-
bioRxiv - Genomics 2022Quote: ... DNA was purified using a Monarch PCR & DNA Clean up kit (NEB, T1030) and eluted in 12 μL of water.
-
bioRxiv - Genomics 2022Quote: The ligation reaction was carried out using Quick Ligation™ kit (NEB, M2200). A 10 μl mixture consist of 1 μl of 1 μM N40+22nt DNA (0.1 μM final) ...
-
bioRxiv - Genomics 2020Quote: ... Libraries were generated using NEBnext Ultra DNA library preparation kit for Illumina (NEB). Libraries were sequenced by paired-end sequencing using a NextSeq 500 (Illumina).
-
bioRxiv - Microbiology 2020Quote: ... the source plasmid (p-retronWT) was mutagenized through PCR using a kit (NEB; Q5-Site-Directed Mutagenesis Kit ...
-
bioRxiv - Molecular Biology 2021Quote: All mutagenesis was done using Q5 Site-directed Mutagenesis Kit Protocol (NEB #E0554S) according to the manufacturer’s instructions using primers in table T1 ...
-
Efficient Suppression of Endogenous CFTR Nonsense Mutations Using Anticodon Engineered Transfer RNAsbioRxiv - Molecular Biology 2021Quote: ... gel purifications were performed using the Monarch DNA Gel Extraction Kit (NEB T1020L), and minipreps were performed using the Monarch Plasmid Miniprep Kit (NEB T1010L) ...
-
bioRxiv - Molecular Biology 2021Quote: ... NGS libraries were made using NEBNext Ultra II DNA Library Prep kit (NEB). DNA sequencing was performed on Illumina MiniSeq with 150+150 bp paired-end protocol.
-
bioRxiv - Cancer Biology 2019Quote: ... Variants were generated using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs). Plasmid transfection was performed with Lipofectamine 3000 (Invitrogen) ...
-
bioRxiv - Microbiology 2020Quote: ... and reverse-transcripted to cDNA using LunaScript RT SuperMix kit (New England Biolabs) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... PCR was done with the Phusion High-Fidelity PCR kit (New England BioLabs) with 40ng of gDNA ...
-
bioRxiv - Plant Biology 2019Quote: TNIC317S active site mutant was generated using Q5 Site-Directed Mutagenesis Kit (NEB).pGEM-T-TNI served as a template for making the site directed mutant using primers P2346 and P2347 ...
-
bioRxiv - Genomics 2019Quote: ... the DNA was treated with repair enzymes (New England Biolabs PreCR kit M0309) and purified using Qiagen PCR purification columns as above.