Labshake search
Citations for New England Biolabs :
2301 - 2350 of 7751 citations for 6 methyl 5 4 phenyl 1 3 thiazol 2 yl 2 trifluoromethyl nicotinic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: The plasmids used in this study were obtained from the sources as noted in Table 2 or made by either restriction digest and ligation or PCR and NEBuilder HiFi DNA assembly (New England Biolabs E5520S). Insert sequences were ordered as custom GeneBlocks from IDT or isolated from existing plasmids ...
-
bioRxiv - Genomics 2024Quote: ... Amplicons were then barcoded for NGS by combining 2 µL of amplicon from the previous PCR with 1X Q5 High-Fidelity Master Mix (New England Biolabs M0492) and 500 nM forward and reverse indexing primers (Integrated DNA Technologies) ...
-
bioRxiv - Cancer Biology 2024Quote: ... followed by PCR amplification of the BC-sgRNA1-sgRNA2 region from 32 μg of bulk lung genomic DNA using Q5 Ultra II High-Fidelity 2× Master Mix (New England Biolabs, M0494X). Unique dual-indexed primers were used to amplify each sample followed by purification using Agencourt AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Biophysics 2023Quote: Tau was phosphorylated in vitro according to previous protocols with some modifications.12,88 50 µL of 100 µM tau was incubated with 2 µg cAMP-dependent Protein Kinase (PKA, New England BioLabs P6000S) and/or 0.4 µg GSK3β (Sigma-Aldrich G4296 ...
-
bioRxiv - Neuroscience 2023Quote: ... Final nuclear lysates were resuspended using 100 µl of resuspension solution (1x PBS + 2% BSA + 0.2U/µl RNase inhibitor - New England Biolabs, Cat#: M0314S). Hoechst staining was performed to assess the quality of isolated nuclei based on their shape ...
-
bioRxiv - Pathology 2023Quote: ... cDNA then was used as a template for barcoding PCR following ONT’s protocol (SQK-LSK110 with EXP-PBC096) and LongAmp Taq 2× Master Mix (NEB, Ipswich, MA). The barcoded amplicons were bead purified at a 0.8× beads:solution ratio before being pooled by equal volume with libraries from unrelated samples and a library generated from HeLa RNA (ThermoFisher)
-
bioRxiv - Molecular Biology 2022Quote: ... pHAGE lentiviral plasmids encoding the six other HCoV N-EGFP were generated by replacing SARS-CoV-2 N with the respective HCoV N sequences by PCR (New England Biolabs M0492S) and NEBuilder HiFi DNA Assembly (New England Biolabs E2621S) ...
-
bioRxiv - Genetics 2023Quote: Library oligos for the prime editing screen were synthesized by Twist Bioscience and amplified using the NEBNext High-Fidelity 2× PCR Master Mix (NEB M0541L) with the forward primer GTGTTTTGAGACTATAAATATCCCTTGGAGAAAAGCCTTGTTT and the reverse primer CTAGTTGGTTTAACGCGTAACTAGATAGAACCGCGGTGTTAGG ...
-
bioRxiv - Biophysics 2023Quote: ... These plasmids were digested with NotI-HF and XhoI for 2 h at 37°C (R3189, R0146, New England Biolabs, UK) and heat-inactivated for 20 min at 80°C.
-
bioRxiv - Genomics 2023Quote: ... thirty 20 μl ePCRs were performed using 400 ng of DNA for each reaction and NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541S) with the following primers ...
-
bioRxiv - Biochemistry 2023Quote: ... The mutant and wild-type target RNA were subsequently amplified using either the NEB Luna SARS-CoV-2 RT-qPCR Multiplex Assay Kit (NEB E3019), Luna Probe One-Step RT-qPCR 4X Mix with UDG (NEB M3019 ...
-
bioRxiv - Cell Biology 2022Quote: ... The mutant fragments were amplified by high-fidelity DNA polymerase 2 × Phanta Max Master Mix followed by DpnI (New England BioLabs; R0176S) digestion in 37°C for 1 hour to eliminate the templates ...
-
bioRxiv - Genetics 2023Quote: ... PCR products were analyzed on 2% Agarose gels with 0.5 ng/L Ethidium bromide using a 1kb Plus DNA Ladder (New England BioLabs Cat # N3200S) for size reference ...
-
bioRxiv - Molecular Biology 2023Quote: ... All mRNAs were transcribed at 30°C for 2 hrs using the HiScribe T7 High Yield RNA Synthesis Kit (NEB # E2040S) and were co-transcriptionally capped (8:1 cap analog to GTP for ∼90% capping efficiency ...
-
bioRxiv - Biochemistry 2023Quote: ... was used to linearize plasmid (10 µg) by incubating at 37 °C for a minimum of 2 hours in 1x CutSmart buffer (NEB, B7204S). Linearized plasmid was purified by extraction with an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Libraries were created using 1000ng of total RNA with the NEBNext Ultra 2 Directional RNA Library Kit following the Poly(A) mRNA Magnetic Isolation module (NEB #E7490). Libraries were sent to Novogene for Illumina Hi-Seq ...
-
bioRxiv - Developmental Biology 2023Quote: ... The 2-kpb cbln12 promoter (Dohaku et al., 2019) and lTl-Kaede-pAS were subcloned to pT2ALR-Dest by NEBuilder (NEB, USA). To generate Tg(5xUAS-hsp70l:HA-skor2-P2A-mCherry ...
-
bioRxiv - Plant Biology 2023Quote: ... and PEP444c were amplified using a cDNA template obtained from 2-week-old barley shoots and roots and Q5® High-Fidelity DNA Polymerase (New England BioLabs) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... The cDNAs were diluted 1:10 and 2 μl of each used for subsequent PCR reactions with one unit of Taq polymerase (New England Biolabs, MA), 200uM dNTPs (New England Biolabs ...
-
bioRxiv - Genomics 2023Quote: Library oligos for the MYC enhancer screen were synthesized by Twist Bioscience and amplified using the NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L), forward primer ...
-
bioRxiv - Genetics 2023Quote: ... were carried out with 3 nM of each DNA fragment from the master mix and 2 µL of the NEBridge Golden Gate Assembly Kit (BsaI-HFv2) (NEB E1601S) in 1X T4 DNA ligase Reaction Buffer ...
-
bioRxiv - Microbiology 2023Quote: ... Amplification of target genes was carried out using a SYBR Green based qPCR mix consisting of Q5® High-Fidelity 2× Master Mix (NEB), SYBR Green ...
-
bioRxiv - Genomics 2023Quote: ... The gDNA is eluted with 25.2uL ddH2O and undergoes a second round of in vitro CpG methylation with previously described parameters above with exception that 10x Mg2+-free buffer is replaced with equal volume of NEB Buffer #2 (New England Biolabs, B7002S). The reaction is incubated again for 4 hours at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... Reactions were performed at 37°C for the indicated time (30 min if not otherwise specified) and then terminated by the addition of 10 μL of 2× RNA loading dye (New England Biolabs, USA). Reaction samples were heated at 85°C for 2 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... 14-3-3ζ with different conjugated molecules and BAD variants conjugated with mCitrine were subcloned to the multiple cloning site (MCS-2) using EcoRI and XbaI (NEB; # R0145S) and the MCS-1 using MluI-HF (NEB ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and the targeted DNA region was amplified by PCR using the biomass as the template with the Q5™ High-Fidelity 2× master mix (New England Biolabs). Base-editing efficiency when targeting a plasmid-borne gene was estimated by isolating plasmid DNA upon 24-h editing treatment by using the NucleoSpin™ plasmid EasyPure kit (Macherey-Nagel ...
-
bioRxiv - Molecular Biology 2023Quote: ... Oligos for side 1 and 2 were dimerized separately by mixing 9 μl of OligoA at 100 μM with 9 μl of OligoB at 100 μM and 2 μl of 10x DNA Ligase Buffer (NEB, M0202S) and heating to 95 °C for 5 minutes ...
-
bioRxiv - Cell Biology 2024Quote: RNA encoding indicated HSP90B1 nascent chains were prepared from PCR amplified and purified DNA template containing a T7 promoter and carried out at 37°C for 2 hours using the HiScribe® T7 High Yield RNA Synthesis Kit (New England Biolabs) and purified using the RNeasy Mini Kit (Qiagen) ...
-
bioRxiv - Synthetic Biology 2024Quote: Transcription templates for expressing gRNA variants and SARS-CoV-2 or CMV input RNA fragments were generated by PCR (Phusion high-fidelity PCR kit, NEB #E0553) of the gBlock or Ultramer template that included a T7 promoter and the gRNA or input RNA coding sequence ...
-
bioRxiv - Genetics 2024Quote: ... 250 ng of RNA samples were digested at 37°C for 2 hours with Nucleoside Digestion Mix (New England Biolabs, M069S). Digested RNA samples were diluted to 100 µl with double-distilled water and filtered through 0.22 µm Millex Syringe Filters ...
-
bioRxiv - Genomics 2024Quote: ... The reaction was purified using the Zymo DNA Clean & Concentrator kit and PCR-amplified with NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L) and primers as defined in Corces et al ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... ddRAD library preparation included an initial digestion of 300 ng of DNA in a 34 μL reaction (2 hours at 37 °C; 10 U each of SbfI and MspI, New England Biolabs Inc.). Standard Illumina adapters were ligated using 60 cycles of digestion at 37 °C (2 minutes ...
-
bioRxiv - Neuroscience 2024Quote: ... Final nuclear lysates were resuspended using 100 µl of resuspension solution (1x PBS, 2% BSA, 0.2U/µl RNase inhibitor; New England Biolabs, cat# M0314S). Hoechst staining was performed to assess the quality of isolated nuclei based on their morphology ...
-
bioRxiv - Neuroscience 2024Quote: ... and Gas5 shRNAs (shRNA # 1= G5C1 and shRNA # 2= G5C2) were cloned by replacing the existing Luciferase shRNA (shRLuc) under a U6 promoter using BamHI (NEB #R0136L) and EcoRI restriction sites (Table 3) ...
-
bioRxiv - Neuroscience 2020Quote: ... After overnight incubation at 4°C in PBS-Perm with rabbit anti-GFP (1:1000, Biolabs) and mouse anti-MAP2 (1:2000 ...
-
bioRxiv - Plant Biology 2023Quote: ... 4 pmol of double-stranded DNA was labeled with 1 unit of Klenow fragment polymerase (NEB) and 8 pmol Cy5-dCTP (Cytiva ...
-
bioRxiv - Biophysics 2019Quote: ... using a 5-fold excess of fluorophore to protein and ∼1 μM Sfp synthase (NEB) for 16 hours at 6 °C in 50 mM TRIS-HCl pH 7.5 ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg standard glycoprotein was mixed in 1 μL of 10× glycoprotein denaturing buffer (NEB) (final conc ...
-
bioRxiv - Biochemistry 2020Quote: ... 5:1 molar ratio of insert to backbone and 1X Gibson Assembly Master Mix (NEB) and incubated at 50°C for 1 hour before transformation into One Shot TOP10 Chemically Competent E ...
-
bioRxiv - Biochemistry 2020Quote: ... 5:1 molar ratio of insert to backbone and 1X Gibson Assembly Master Mix (NEB) and incubated at 50°C for 1 hour before transformation into One Shot TOP10 Chemically Competent E ...
-
bioRxiv - Microbiology 2020Quote: ... T5 exonuclease diluted 1:5 with 5X reaction buffer (New England BioLabs; 0.01 units/μL), Taq DNA ligase (New England BioLabs ...
-
bioRxiv - Biochemistry 2022Quote: ... 5 μl of 2x Quick Ligase buffer and 1 μl of Quick ligase (NEB, M2200) in a final volume of 10 μl was incubated for 10 min at RT and then used to transform DH5α competent cells ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.01% Igepal CA-630 and 5% glycerol) with 1 U/µL murine RNase inhibitor (NEB), 0.1 µg/µL T7 RNA polymerase (purified in-house ...
-
Disruption of the Aspergillus fumigatus RNA interference machinery alters the conidial transcriptomebioRxiv - Microbiology 2023Quote: ... the isolated RNA was treated with 1 μl (5 units) RppH enzyme (New England Biolabs) in NEB Buffer 2 (50 mM NaCl ...
-
bioRxiv - Cell Biology 2023Quote: ... using 5 μl of the reaction with 1 μl of loading dye (New England Biolabs). Agarose gel was electrophoresed at 70V until resolution of bands required was reached ...
-
bioRxiv - Biophysics 2019Quote: ... HIV-1 MAG2A-ΔHBR-EGFP was generated from HIV-1 MAG2A-EGFP by deleting amino acids 18-32 using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs, Ipswich, MA). pEGFP-N1 and pEYFP-N1 were obtained from Clonetech (Mountainview ...
-
bioRxiv - Molecular Biology 2022Quote: ... using the random primer method (Random Primer 6, NEB S1230S ...
-
bioRxiv - Biochemistry 2019Quote: ... and terminated by adding 6× DNA loading buffer (NEB). For cleavage assay presented in Figs ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 4: 4°C hold) using NEB Next High-Fidelity master mix (NEB) in 25 µl reaction volume using RAD-Marker for/ RAD-Marker rev primers (25 nM each ...
-
bioRxiv - Immunology 2024Quote: ... Insert and vector were combined at a 5:1 ratio and held at 50 °C for 1 hour in NEBuilder® HiFi DNA Assembly Master Mix (NEB). Gibson assembly products were purified using the MinElute® PCR Purification Kit (Qiagen) ...