Labshake search
Citations for New England Biolabs :
2251 - 2300 of 4067 citations for SARS CoV 2 Spike Glycoprotein S2 aa 1000 1200 His Tag E. coli since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: AtXRCC4 fused to a hexa-histidine followed by a GST tag (pGAT3-atxrcc4) was expressed in BL21(DE3) cells (NEB), The proteins were purified using GST sepharose (Cytiva) ...
-
bioRxiv - Microbiology 2023Quote: ... encoding a C-terminal myc tag were cloned into NcoI and HindIII sites of pHERD20T-myc and pHERD30T-myc using Gibson Assembly (NEB) or Hifi Assembly (NEB) ...
-
bioRxiv - Biochemistry 2023Quote: ... A TEV protease cut site preceding the 6x histidine tag was previously introduced using the Q5 Site-Directed Mutagenesis Kit from NEB and the GeneJET Plasmid Miniprep Kit from ThermoFisher ...
-
bioRxiv - Microbiology 2023Quote: ... Specific forward primer targeting E1 and a reverse primer targeting the nongenomic tag were used in 20 ul SYBR Green reaction with 1x Luna qPCR Dye (New England Biolabs) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... standard curve transcripts and viral RNA in the samples were reverse transcribed with a reverse E1 primer containing a nongenomic tag sequence74 5’-CAGACAGCACTCGTTCGTACAC-3’ through the Protoscript II First Strand cDNA Synthesis Kit (New England Biolabs). The (+ ...
-
bioRxiv - Cell Biology 2023Quote: ... with an N-terminal human CD33 signaling peptide and C-terminal 12xHis purification tag was codon optimized and ordered as a gBlocks Gene Fragment (IDT) with overhangs for Gibson assembly (NEB). The sequence was engineered to have a single Cys in the EC5 domain for site-specific labeling as previously described11 ...
-
bioRxiv - Molecular Biology 2023Quote: ... was amplified from afp18-3CTS with primers including a stop codon before the tag and closing the linear fragment using the KLD enzyme mix from New England Biolabs (NEB). Positive clones were confirmed with colony PCR ...
-
bioRxiv - Molecular Biology 2024Quote: ... The peptides obtained by trypsin digestion were subsequently labeled as directed by the tandem mass tag (TMT) kit (PTM Biolabs). The labeling peptides were then fractionated by high pH reverse-phase high-performance liquid chromatography and further subjected to liquid chromatography with tandem mass spectrometry (LC-MS/MS ...
-
bioRxiv - Molecular Biology 2023Quote: ... Coli vectors expressing SAHS proteins without SUMO tags were ordered and synthesized from Twist Bioscience and transformed into LEMO21(DE3) competent cells (NEB). To test for the effects of intracellular SAHS expression ...
-
bioRxiv - Biophysics 2023Quote: ... The full length KIF5B in pACEBac1 was replaced with a C-terminal TEV-Twin-Strep-tag via HIFI DNA assembly kit (NEB). The TRAK1 construct was made through assembling His-ZZ-TEV-SNAP tag and TRAK1(1-395 ...
-
bioRxiv - Biophysics 2024Quote: ... Recombinant BimC plasmid was generated by integration of the BimC cDNA fragment into a modified Novagen pET-17b vector containing a 6xHis-tag and a GFP using Gibson Assembly (NEB). Plasmid region corresponds to the 71-1184 amino acids of BimC and the modified vector was amplified and assembled with KLD Enzyme Mix Reaction (NEB ...
-
bioRxiv - Biochemistry 2024Quote: ... Tag variants were generated by ligating synthetic dsDNA oligos (IDT) encoding each respective tag downstream of GFP bewteen BamHI and HindIII sites (NEB). In order to generate the GFP-VapCYALAA fusion ...
-
bioRxiv - Microbiology 2024Quote: ... SINV-REP construct derived from pToto64 clone encoding SINV non-structural proteins and a reporter luciferase tag was linearized using SacI (New England Biolabs), followed by in vitro transcription using SP6 RNA polymerase (New England Biolabs) ...
-
bioRxiv - Genomics 2019Quote: ... The DNA (50-100 ng) was amplified using the Phusion Hi-Fi PCR master mix with HF buffer (New England Biolabs M0531) or the Q5 Hot Start HiFi PCR master mix (New England Biolabs E6625AA ...
-
bioRxiv - Cell Biology 2020Quote: ... was performed using 10ng of His tagged PTP-PEST (WT) plasmid as template and followed by Dpn1 (New England Biolabs, UK) digestion for 2 hours at 37°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3 µl Hind III (Fisher, FD0504), 3 µl EcoRI (Fisher, FD0274), and 3 µl Bam HI (Fisher, FD0054) in RNase H buffer (NEB, M0297) overnight at 37 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 µg DNA was digested with 3 µl Hind III (Fisher, FD0504), 3 µl EcoRI (Fisher, FD0274), and 3 µl Bam HI (Fisher, FD0054) +/-5 µl RNase H (NEB, M0297) in RNase H buffer (NEB ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were then divided into two aliquots and treated with and without 100 U M.CviPI GpC methyltransferase (100 U/million cells; New England Biolabs, M0227B-HI) supplemented with fresh 160 μM S-adenosyl-L-methionine for 15 min at 37ºC ...
-
bioRxiv - Biochemistry 2024Quote: ... Truncated EWSR1 constructs were created by PCR-based cloning from the His-MBP-EWSR1 expression vector using inverse PCR with Phusion DNA polymerase (New England Biolabs, F530S) then DpnI digest (New England Biolabs ...
-
bioRxiv - Cell Biology 2023Quote: ... were combined using a the NEBuilder Hi-Fi DNA assembly kit according to the manufacturer’s instructions (E5520, New England BioLabs, Waltham, MA). The resulting product was transformed into then transformed into competent cells (C2987 ...
-
bioRxiv - Cell Biology 2023Quote: ... These fragments were combined using a the NEBuilder Hi-Fi DNA assembly kit according to the manufacture’s instructions (E5520, New England BioLabs, Waltham, MA). The resulting product was transformed into then transformed into competent cells (C2987 ...
-
bioRxiv - Neuroscience 2021Quote: ... 2 (NEB #E7500) and 3 (NEB #E7710 ...
-
bioRxiv - Molecular Biology 2021Quote: ... PARP1 and SET8 GST-fusion and mutant proteins were induced in Escherichia coli ER2566 cells (New England Biolabs
-
bioRxiv - Microbiology 2022Quote: ... coli and ligated to one end using Golden Gate assembly with BsmBI and T4 DNA ligase (NEB, Vazyme). All oligos and the corresponding templates used in the cloning for these experiments are outlined in Table S6 ...
-
bioRxiv - Immunology 2020Quote: ... and the assembled plasmid pCO1 was transformed into NEB® 5-alpha competent Escherichia coli (High Efficiency) (NEB) according to manufacturer’s instructions (see Supplementary Figure 1 for plasmid maps) ...
-
bioRxiv - Microbiology 2022Quote: ... Escherichia coli NEB® 5-alpha was used for plasmid assembly and cloning following the manufacturer’s instructions (NEB). Transformed E ...
-
bioRxiv - Molecular Biology 2022Quote: The recombinant pET6xHN-N constructs were transformed into Escherichia coli strain BL21(DE3) (New England Biolabs, MA, USA). The transformed clones were cultured at 37 °C in LB medium with 100 μg/mL Carbenicillin and were induced by adding 1 mM isopropyl β-D-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Biochemistry 2022Quote: Selenomethionine-derivatized FL-TgGAC was expressed in the methionine auxotroph T7 Express Crystal Escherichia coli strain (NEB #C3022) cultured in SelenoMethionine Medium Base plus Nutrient Mix (Molecular Dimensions MD12-501) ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli in vitro transcription were synthesized through a 200 µL PCR reaction containing 10x Taq Buffer (NEB, #B9014S), 250 µM dNTP Mix (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli strain MET961 was constructed by replacing the glgB gene of strain NEB 5-alpha (New England Biolabs) with the glgB::Kan-pWV01repA region from E ...
-
bioRxiv - Cell Biology 2024Quote: ... The resulting assembly mixture was transformed into chemically competent Escherichia coli (C2987H) through a High Efficiency Transformation (NEB). Colonies were isolated via growth on selective media (LB carbenicillin+) ...
-
bioRxiv - Microbiology 2024Quote: ... coli 1094 bcsAHA-FLAG strain as a template and a high-fidelity DNA polymerase (Phusion, New England Biolabs) with appropriate restriction sites introduced in the 5′ primer overhangs (sense/antisense PstI/NotI) ...
-
bioRxiv - Neuroscience 2020Quote: ... 1:1000 concentrations of SNAP-Surface 488 (NEB #S9124 ...
-
bioRxiv - Bioengineering 2021Quote: ... with 1000 units of T4 DNA Ligase (NEB), and 30 units of BsaI-HF V2 (NEB ...
-
bioRxiv - Cancer Biology 2024Quote: ... TOM20 at 1:1000 (New England Biolabs 42406S) were prepared in TBST with 3% bovine serum albumin (BSA) ...
-
bioRxiv - Cell Biology 2023Quote: ... and anti-H4K12la (PTM BIOLABS, 1:1000, PTM1411RM). The next day ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-succinyllysine (PTM Biolabs, PTM-401, 1:1000), anti-MYC (and anti-SUCLG2 (Bethyl Laboratories ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Ni-NTA resin elute was immediately diluted with PBS containing 1 mM EDTA (PBS-E) and incubated with amylose resin (New England Biolabs) for 30 min ...
-
bioRxiv - Cell Biology 2020Quote: ... 1μl of each lysate was used as a PCR template to amplify 600-800 bp fragments around the edited E-box using the Q5 High-Fidelity 2X Master Mix (NEB). The resulting PCR products were purified in 96-well plates using the AmpliClean DNA Cleanup Kit (Nimagen ...
-
bioRxiv - Microbiology 2021Quote: ... Insertion of hACE2 into pLVX-IRES-puro was conducted by doubl e digestion of XhoI and XbaI (Fermantas) and ligation of T4 ligase (NEB) according to manufact urer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... were generated by extending a common sgRNA(F+E) sequence with gene-specific crRNA sequence downstream of a T7 promoter by PCR with Phusion polymerase (NEB). PCR product was gel extracted and sgRNA was in vitro transcribed using the MegaShortScript™ T7 Transcription Kit (Invitrogen AM1354 ...
-
bioRxiv - Biophysics 2023Quote: ... the mixtures were deproteinized by adding pronase E (4 μg/μl) and 1X purple gel loading dye (New England BioLabs) and incubated at 55°C for 30 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... These PCRs were performed with the specified primer sets (a, c and e or b, d and f) and Q5 High-Fidelity Polymerase (NEB) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... and YQDA (D434W Y415A A463W Q433W) fused to a mCherry N-terminal tag were cloned using the NEBuilder HiFi DNA Assembly Cloning Kit (NEB #E5520) and introduced into pBlueScriptII with a VHA-6 promoter and tub terminator using the primers pvha6_fwd gacggtatcgataagcttgatatcggtatactatttattactcgatacttttg ...
-
bioRxiv - Synthetic Biology 2019Quote: ... A FLAG surface tag was C-terminally appended to MxEnc and QtEnc using Q5® Site-Directed Mutagenesis (New England Biolabs). QtEncFarn was generated by appending a minimal C-terminal farnesylation signal (GCMSCKCVLS ...
-
bioRxiv - Biochemistry 2022Quote: ... The library was cloned into a pENTR1A plasmid backbone with a C-terminal YFP HA reporter tag using Gibson Assembly (HiFi DNA Assembly Cloning Kit, New England Biolabs, (NEB), Ipswich ...
-
bioRxiv - Biochemistry 2022Quote: ... was cloned into pGex6P-1 in-frame with an N-terminal 3C-cleavable GST tag using HiFi assembly (New England Biolabs, USA).
-
bioRxiv - Cell Biology 2022Quote: ... were amplified by PCR and subcloned into pMRX-IP backbone vector together with the EGFP tag by Gibson Assembly (New England Biolabs, E2611L). All deletion and point mutation mutants of LC3B and GABARAP were generated by a PCR-based method.
-
bioRxiv - Molecular Biology 2022Quote: ... and BGH reverse (5’-TAG AAG GCA CAG TCG AGG -3’) primers from the pcDNA3.1+/-C-(K)-D vector using standard methods (NEB 2x Q5) which include 5-10 ng DNA per reaction ...
-
bioRxiv - Neuroscience 2019Quote: ... A V5 tag was inserted before the stop codon by Q5 site-directed mutagenesis kit (New England Biolabs, Ipswich, MA, USA). Afterwards ...