Labshake search
Citations for New England Biolabs :
2251 - 2300 of 3282 citations for Herpes Simplex Virus 1 Antigen since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2020Quote: ... and subsequently mixed at a 6:1 ratio with the digested backbone in reactions containing T4 DNA ligase (NEB).
-
bioRxiv - Genetics 2019Quote: ... Data were reported as the nearest kilobase using the 1 kb DNA ladder (New England Biolabs, Beverly, MA, USA) as a reference.
-
bioRxiv - Molecular Biology 2019Quote: ... Beads were washed twice with ELBS and suspended in 20 μL PMP buffer supplemented with 1 mM MnCl2 (NEB). 200 units λ protein phosphatase (NEB ...
-
bioRxiv - Biochemistry 2020Quote: ... 1 μg ml−1 of template DNA was mixed with 1000 U ml−1 of T7 polymerase and 1.5 mM of each rNTP (New England Biolabs) in 40 mM Tris-HCl ...
-
bioRxiv - Genetics 2020Quote: Total RNA was extracted using the standard hot acid phenol method and treated with DNase 1 (New England Biolabs). qRT-PCR was performed using amfiRivert cDNA synthesis Platinum Master Mix from Gendepot ...
-
bioRxiv - Genomics 2021Quote: ... 1% of the cDNA was used for each qPCR reaction performed with the Luna Universal qPCR Mastermix (NEB M3003) and the PCR primers listed (Supplementary Table1) ...
-
bioRxiv - Genomics 2020Quote: ... Primer mixes were diluted 1:25 and 1μl of each mix was used for overlap-extension PCR using Phusion (NEB). Four 50μl reactions for each mix were performed using cycling conditions 98°C 1min ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... UK) were then synthesized through in vitro transcription of 1 mg template with T7 polymerases (M0251, New England Biolabs). The sections were fixated in 4% PFA ...
-
bioRxiv - Microbiology 2021Quote: Protein samples were generated by collecting the pellet for 1 ml of cells at OD600 ∼ 1.0 and lysing with 100 µl 1X SDS sample buffer (New England Biolabs) and DTT by boiling for 10 min ...
-
bioRxiv - Cell Biology 2021Quote: ... RHA PCR products were ligated into pAAV p21 vector by Gibson assembly at a ratio vector:inserts of 1:2:2 using T4 DNA ligase (NEB). All constructs were checked by sequencing before transfection into cells ...
-
bioRxiv - Bioengineering 2021Quote: ... Resulting amplicons were denatured and reannealed in a thermocycler before nuclease reaction using T7 Endonuclease 1 (New England Biolabs) at 37C for 20min ...
-
bioRxiv - Bioengineering 2020Quote: ... Constriction was performed by diluting a library to approximately 8 fM (~5,000 molecules/μl) in salmon sperm DNA (1 ng/μl, New England Biolabs) in low-binding tubes (LoBind ...
-
bioRxiv - Biochemistry 2021Quote: ... 500 μg of “heavy” or “light” THP-1 protein extract were dephosphorylated with 50 U of Antarctic phosphatase (NEB) in Antarctic phosphatase buffer (NEB ...
-
bioRxiv - Biochemistry 2021Quote: ... The fragment was ligated into the pLSV101 vector (3:1 molar ratio) with T4 DNA ligase (New England Biolabs) (16 °C overnight) ...
-
bioRxiv - Biochemistry 2020Quote: ... Remodeling reactions were started by adding 10 μl SGD chromatin corresponding to about 1 μg DNA assembled into nucleosomes and terminated by adding 0.8 Units apyrase (NEB) followed by incubation at 30 °C for 30 min.
-
bioRxiv - Biochemistry 2020Quote: ... supplemented with 1 mM MnCl2 was used to remove the phosphorylation on the peptides and Staurosporin (NEB, Hitchin, UK) to occupy the active site pocket ...
-
bioRxiv - Biochemistry 2021Quote: ... 2.5 μl of reaction was added to a tube containing 5 μl replication buffer and 1 μl MseI (NEB) for 3 min ...
-
bioRxiv - Cell Biology 2021Quote: ... 1 µl was added to a 9 µl Luna® Universal One-Step RT-qPCR reaction (NEB, Cat# E3005L). RT-qPCR was carried out to manufacturer specifications in a CFX96 Touch Real Time PCR Machine (Bio-Rad) ...
-
bioRxiv - Plant Biology 2021Quote: ... High fidelity PCR was conducted on the abcg43-1 line using the Q5 High-Fidelity 2X Master Mix (NEB). PCR products were purified and extracted from a 1% agarose gel using the QIAquick Gel Extraction Kit (QIAGEN) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 96-well plates were centrifuged again at 3000 x g for 10 min and 1 µL of the supernatant was used in 12.5 µL PCR reactions with Taq polymerase (NEB) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... before incubation during 6 min in 50μl of PNK reaction mix (1x PNKT, 1 mM ATP and 0.05 U/ml T4 PNK 3′phosphatase minus (NEB) in a thermomixer at 37°C and 1400rpm ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was synthesized from 0.5-1 µg of RNA per sample using Protoscript II RT and Random Primer Mix (New England Biolabs). qPCR reactions were performed on cDNA using iQ SYBR Green supermix (BioRad) ...
-
bioRxiv - Microbiology 2020Quote: ... 107 epimastigotes were electroporated with 2.5 µg of pTRIX2-GFP plasmid (Fig 1 A) linearized with AscI and SacI (NEB). The plasmid had been derived from pTRIX-REh9 [28] ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... 1:8 dilution Cas9 protein (New England Biolabs, cat. M0386M; diluted in buffer B, New England Biolabs, cat. B802S) and 1:40 dilution of phenol red (Sigma Aldrich) ...
-
bioRxiv - Neuroscience 2022Quote: ... cDNA was synthesized from 1 μg total RNA using the ProtoScript® II First Strand cDNA Synthesis Kit (NEB) with oligo-dT priming according to the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2022Quote: ... The coupling reaction was performed at 25 °C for 1 h and followed by addition of 0.2 unit/mL apyrase (New England Biolabs). After additional 1 h at 25 °C ...
-
bioRxiv - Biochemistry 2022Quote: ... Reactions were dialyzed with water on silica membranes (0.025 μm pores) for 1 hour before transformed into DH10β cells (New England Biolabs). Library sizes of at least 100,000 colony-forming units (CFU ...
-
bioRxiv - Biochemistry 2022Quote: Native 3’ end extension assays experiments where set-up as describe in the D-loop assays with the exception that dNTP’s (1 mM) and Klenow (exo-)(NEB) were added after 10 minutes of D-loop formation ...
-
bioRxiv - Genetics 2022Quote: ... The human codon-optimized Cas9 gene (Supplementary file 1) was synthesized by HuaGene (Shanghai, China) and cloned into the Nme2Cas9_AAV backbone by the NEBuilder assembly tool (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... 25mM Tris-HCl) and then lysed using TD/1% NP-40/RVC (Ribonucleoside-Vanadyl Complex, NEB, Cat. No. S1402) in the presence of RNaseOUT™ Recombinant Ribonuclease Inhibitor (Thermo Fisher ...
-
bioRxiv - Developmental Biology 2020Quote: ... standard PCR reactions were performed on 1 ul of cDNA using Q5 High-Fidelity DNA Polymerase (New England Biolabs) and each of the variant PCR primer pairs independently ...
-
bioRxiv - Plant Biology 2021Quote: ... We sent 300ng of DNA in 20μl to LGC Genomics GmbH (Germany) where genomic DNA were digested with 1 Unit MslI (NEB) in 1 times NEB4 buffer in 30 μl volume for 1 h at 37 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were treated for 15 minutes at 37°C with 1 μM BG-SS-649 (Marzook et al., 2021) (a gift from Dr Ivan Corrêa Jr, New England Biolabs) in complete media to reversibly label surface SNAP-tagged receptor populations ...
-
bioRxiv - Molecular Biology 2021Quote: ... Two separate 8-µl aliquots of beads derived from each strain were treated with 1 µl lambda phosphatase (NEB) in 10 µl reactions containing ...
-
bioRxiv - Microbiology 2021Quote: ... the THN gene was ligated to pICH41021 in a 3:1 molar ratio using T4 Ligase (New England Biolabs) at 4°C overnight and transformed by heat shock into chemically competent E ...
-
bioRxiv - Molecular Biology 2019Quote: ... Ncas_Int679_For 5′ GGCAAATTTGTATGAGGGATAAA and Ncas_Int679_Rev 5′ TAATTCGATTACGTTAGCTGTT) and cloned into pRS403-pGAL1-hpSC_URA3 (1) using PsiI and NaeI restriction enzymes (New England Biolabs, NEB). In addition ...
-
bioRxiv - Cell Biology 2021Quote: ... COS-7 cell lysates from FLAG-ACBD4(wACBD5_FFAT)/5 (mFFAT) expressing cells were treated for 1 h with λPP (New England BioLabs) as described above ...
-
bioRxiv - Microbiology 2021Quote: ... First strand cDNA synthesis was done by incubating 1 μg total RNA with 2.5 mM Oligo dT(18) and 0.5 mM dNTP mix (NEB, N0447L) for 5 min at 70°C before placing on ice for 2 min ...
-
bioRxiv - Immunology 2020Quote: ... Amplicon DNA was denatured and reannealed in a thermocycler prior to cleaving by T7 Endonuclease 1 (New England Biolabs) at 37°C in a 30min reaction ...
-
bioRxiv - Biochemistry 2020Quote: Every single stranded oligonucleotide (1 nmol) was 5’-end-phosphorylated with 40U of T4 Polynucleotide kinase (New England Biolabs) by incubation at 37°C in 1x T4 DNA Ligase Reaction Buffer.
-
bioRxiv - Cancer Biology 2021Quote: ... 25mM Tris-HCl) and then lysed using TD/1% NP-40/RVC (Ribonucleoside-Vanadyl Complex, NEB, Cat. No. S1402) in the presence of RNaseOUT™ Recombinant Ribonuclease Inhibitor (Thermo Fisher ...
-
bioRxiv - Neuroscience 2022Quote: ... so the bead-bound proteins were dephosphorylated in wash buffer containing 1:50 Lambda Protein Phosphatase (New England Biolabs) and 1 mM MnCl2 to make the phosphosites more accessible for a kinase assay ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 1 μl of 10mM dATP and 3 μl of 5 U/μl Klenow fragment 3’ -> 5’ exo- (NEB M0212) in the thermocycler with the following program ...
-
bioRxiv - Immunology 2022Quote: ... was mixed with backbone vector at 1:2.5 mass ratio in Golden Gate reaction using BsmBI restriction endonuclease (NEB) and T4 DNA ligase (NEB) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Ligation of the 3’ adapter was done using the T4 RNA Ligase 1 (New England Biolabs, Ipswich, MA, M0204L). Ligation of 5’ adaptor required (i ...
-
bioRxiv - Neuroscience 2019Quote: ... PBT was removed and samples were incubated in SNAP substrate diluted in PBT (SNAP-Surface649, NEB S9159S; 1:1000) for 1 hour at room temperature ...
-
bioRxiv - Genomics 2019Quote: ... Samples were ligated overnight at 16ºC with a DNA / RNA oligo (rP5 _ RND: TTTCCCTACACGACGCTCTTCCGATrCrUrNrNrNrNrNrNrNrN) using T4 RNA ligase 1 (New England Biolabs). RNA integrity after ligation was assayed by agarose gel electrophoresis and poly(A)RNA was purigied using oligo dT magnetic beads ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were collected by centrifuging and resuspended with 100 µL of 0.3% SDS in 1×NEBuffer 2.1(NEB, B7002S) with following shaking at 37°C for 30 minutes at 900 rpm ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 50 ul PCR reactions were set up with approximately 1 ug cDNA and Phusion High-Fidelity DNA Polymerase (NEB) was used ...
-
bioRxiv - Bioengineering 2019Quote: ... were injected over the flow cell 1 in Neb2.1 buffer 1x and Cut Smart buffer 1x (New England BioLabs) respectively ...