Labshake search
Citations for New England Biolabs :
2251 - 2300 of 2342 citations for Alpha Cyclodextrin Solution 5% w v since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: Samples were resuspended in 5 µl 1X NEBNext Cell Lysis Buffer of the NEBNext Single Cell/Low Input RNA Library Prep Kit (NEB, E6420). After 5 min incubation at RT ...
-
bioRxiv - Physiology 2024Quote: ... the following reagents were added to each tube containing 1 cell in ∼5 μL: 2 μL M-MuLV Reverse Transcriptase Reaction Buffer (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Synthetic Biology 2024Quote: ... to further phosphoporylate the amplified dsDNA before the addition of 5 µL of Quick-Ligase enzyme (NEBNext Quick Ligation Module, NEB, UK) and the solution was further incubated at 20 °C for 30 min.
-
bioRxiv - Genomics 2024Quote: ... 1.2 µl of linker oligonucleotide (Integrated DNA Technologies) were mixed with 2 µl 10x 5’DNA adenylation buffer (New England Biolabs, E2610L), 0.095 mM ATP ...
-
bioRxiv - Biochemistry 2024Quote: ... corresponding to both strands of the tRNA His promoter from positions −45 to +76 or DNA mutants were end labeled using [γ-32P] adenosine 5′-triphosphate (ATP) and T4 polynucleotide kinase (New England Biolabs) and purified on a 10% acryl/bisacrylamide ...
-
bioRxiv - Cancer Biology 2024Quote: ... ChIP–seq libraries were prepared from 3–5 ng of ChIPed DNA using NEBNext Ultra II DNA Library Prep Kit (NEB, E7645S), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... The aliquots were then divided into 3 digest reactions of 5 M cells and digested with the NlaIII restriction enzyme (NEB, R0125L). After subsequent proximity ligation and DNA extraction ...
-
bioRxiv - Bioengineering 2024Quote: ... The plasmid pool was then digested with the outer guides M1 and P1 (5 μg plasmid pool, 10 μL M1+P1 Cas9 RNP, 4 μL 10X rCutSmart buffer (NEB, B6004S), and H2O to 40 μL incubated at 37°C for 1 hour) ...
-
bioRxiv - Cancer Biology 2024Quote: ... The end-repaired DNA was ligated with 5 μl Adapter Mix (ONT, SQK-LSK110) using 8 μl NEBNext Quick T4 DNA ligase (NEB, E6056) at 21°C for up to 1h ...
-
bioRxiv - Biochemistry 2024Quote: ... Samples were diluted at a 1:5 ratio with H2O prior to qPCR using Luna Universal qPCR Master Mix (New England Biolabs, #M3003) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... were then ligated to pre-annealed Nano-tRNAseq 5’ and 3’ RNA adapters at room temperature for 2 hours with 20% PEG PEG 8000 (NEB, B10048) using recombinant E ...
-
bioRxiv - Cancer Biology 2021Quote: ... The 3’ adenine overhangs were added to the blunt-end DNA fragments by Klenow Fragment (3’-5’ exo; NEB; Cat. No. M0212L). The DNA fragments were then ligated with diversity-increased custom barcodes (Shi et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... Final concentrations of 5 µM TDP-43-TEV-MBP and the indicated final concentrations of recombinant proSAAS or BSA (NEB BioLabs; B9001S) were achieved by mixing aliquots of a 44 μM stock solution of TDP-43-TEV-MBP with aliquots of stock solutions of either 55 μM proSAAS or 151 μM BSA (both in 5 mM acetic acid) ...
-
bioRxiv - Genetics 2020Quote: For Southern blot analysis 150 ng of mouse DNA was digested with 10 units of BamHI-HF (NEB, Figure 2 and 5), NdeI (NEB ...
-
bioRxiv - Genetics 2021Quote: ... the poly (A) product was broken into pieces at 94 °C for 5-7 min using the Magnesium RNA Fragmentation Module (NEB, MA, USA). The RNA fragments were then reverse-transcribed using the SuperScript™ II Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... nucleic acid (5 μL) was used as template for reverse transcription using LunaScript® RT SuperMix Kit (New England Biolabs, Hitchin, UK) in 20 μL reaction volume ...
-
bioRxiv - Biochemistry 2020Quote: ... The doubly-digested vectors were assembled with a single fragment containing the ORF containing 5’ and 3’ adapters for Gibson assembly using 2x NEB Hifi Mastermix (NEB, Ipswich, MA). The finished constructs were transformed into BL21 Rosetta (DE3 ...
-
bioRxiv - Microbiology 2020Quote: ... reverse primer S-D-Bact-0785-b-A-18 (5’ TAC NVG GGT ATC TAA TCC 3’) and a high fidelity Taq polymerase master mix (Q5, New England Biolabs, Massachusetts, USA). Primer sequences were based on Klindworth et al.24 ...
-
bioRxiv - Molecular Biology 2022Quote: ... cell lysates were adjusted to the same protein concentration using furin cleavage buffer (100 mM Tris-HCL and 1mM CaCl2) and incubated with 5 units of Furin (NEB, Ipswich, MA) for 16 h at 30℃ ...
-
bioRxiv - Microbiology 2022Quote: ... colony PCR was conducted to amplify the 5’ IGR of the major T6 cluster using OneTaq DNA Polymerase (New England Biolabs – MA, USA). PCR products were confirmed with gel electrophoresis and Sanger sequencing by Eton Bioscience Inc ...
-
bioRxiv - Plant Biology 2021Quote: The purified PCR reaction was then A-tailed with 15 units Klenow Fragment (3’ – 5’ exo-) (New England BioLabs; Ipswitch, MA, USA) in 1X NEB Buffer 2 (New England BioLabs ...
-
bioRxiv - Plant Biology 2021Quote: ... 500 ng of the SAP-treated RNA was treated with 12.5 units RNA 5’ Pyrophophohydrolase (RppH; New England BioLabs; Ipswitch, MA, USA) in 1X T4 RNA Ligase Buffer (New England BioLabs ...
-
bioRxiv - Physiology 2021Quote: ... and 72 °C for 5 min) using a Q5 Hot Start High-Fidelity 2× Master Mix (New England Biolabs, Ipswich, MA, USA) and primers containing the restriction sites of SpeI or BglII for subsequent subcloning (F ...
-
bioRxiv - Cell Biology 2020Quote: ... of full-length SEC16A were generated by mutating 10 nucleotides in the silencer-select Sec16A siRNA (5’-CGGAGCUUCUGUUACGAGATT-3’, siRNA id: s19236, Thermo-Fischer Scientific) binding site using Q5® Site-Directed Mutagenesis Kit (NEB, E0554S) following manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: ... 2 μg RNA were incubated for 30 minutes at 37°C with 2 μl RNA 5’ Pyrophosphohydrolase (NEB, M0356, 5,000 units/ml). The reactions were stopped by cleaning up the samples following the ZYMO RNA Clean & Concentrator-5 kit (ZYMO ...
-
bioRxiv - Molecular Biology 2020Quote: Thermocycler was used to denature and anneal 5 µl of PCR product as recommended by manufacturer (EnGen™ Mutation Detection Kit, NEB, E3321S). Thermocycler was adjusted for heteroduplex formation as following ...
-
bioRxiv - Biochemistry 2020Quote: ... or a control motif (5’-GGGACCCTGGGAGGG-3’) were prepared by viral replication using a helper phage M13K07 (New England BioLabs, Cat#N0315S). E.coli XL1-Blue cells were transformed with pBluescript SK(- ...
-
bioRxiv - Plant Biology 2020Quote: ... The suitability of the selected restriction enzyme pair was confirmed by digesting 400 ng of genomic DNA using 5 Units of each restriction enzyme and NEB CutSmart™ buffer (10×) (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Microbiology 2020Quote: ... the algR gene was amplified from gDNA using primers (algR-pUC-5, algR-pUC-3) and subcloned into pUC19 (New England Biolabs, Ipswich, MA). Site-directed mutagenesis was performed by amplification of pUC19::algR with primers (algR-D54E-Fw ...
-
bioRxiv - Developmental Biology 2020Quote: ... Samples were then 3’dephosphorylated by denaturing at 65°C for 5 min and incubating with T4 PNK (NEB, catalog no. M0201S) in a 10 μL reaction (7 μL precipitated RNA ...
-
bioRxiv - Microbiology 2021Quote: ... and total of 5 μg of the five fragments was ligated in an equal molar ratio by T4 DNA ligase (New England Biolabs, Ipswich, MA) at 4°C overnight ...
-
bioRxiv - Microbiology 2021Quote: Vector pFLD was digested with PmlI at 37°C for 2 h and dephosphorylated with 5 U Antarctic phosphatase at 37 °C for 30 min as recommended by the manufacturer (NEB, Ipswich, MA). Subsequently ...
-
bioRxiv - Microbiology 2021Quote: ... 39 μl of each lysate was combined with 5 μl of 10X NEB buffer for Protein MetalloPhosphatases (New England Biolabs, Ipswich, MA), 5 μl of 10 mM MnCl2 and 1-2 μl (400-800 units ...
-
bioRxiv - Cancer Biology 2022Quote: ... to remove the 3’-phosphate group from the uncharged tRNA followed by ligation to 5’-adenylated uniquely barcoded adapters using RNA ligase 2 truncated KQ (New England BioLabs, Cat. # M0351L). The resulting tRNAs were then ligated to a 5’-adaptor ...
-
bioRxiv - Biochemistry 2022Quote: ... and the impurities that were tagged by Chitin Binding Domain were extracted on a gravity-flow column using 5 mL Chitin resin (New England BioLabs, Evry, France). The target proteins were purified with HisTrap HP columns (GE Life Sciences ...
-
bioRxiv - Genomics 2022Quote: ... we amplified a 150 bp sequence using primers pGL3-CDC20_F and pGL3-CDC20_R (Phusion High-Fidelity PCR Master Mix, NEB M0531, Supplemental Table 5) that added restriction sites for SacI and XhoI to the 150 bp sequence ...
-
bioRxiv - Genetics 2022Quote: ... the homology 5’arm and 3’arm was amplified and linked to the pBS backbone with Gibson Assembly Kit (NEB, cat. no.E2611L) as ‘pBS-CG32814-arm’ ...
-
bioRxiv - Plant Biology 2022Quote: ... The doubly digested vectors were assembled with a single fragment containing the ORF containing 5′ and 3′ adapters for Gibson assembly using 2x NEB Hifi Mastermix (NEB, Ipswich, MA). The finished constructs were transformed into BL21 Rosetta (DE3 ...
-
bioRxiv - Microbiology 2022Quote: ... and we amplified mEmerald including vector sequence but omitting the mitochondrial targeting sequence from the mEmerald-Mito-7 plasmid using primers mEmeraldVector forward (5’ TGGATCCATGGGGGATCCACCGGTCGCC 3’) and mEmeraldVector reverse (5’ ACACCGACATGCTAGCGGATCTGACGGTTCAC 3’) and combined the fragments using a HiFi assembly kit (New England Biolabs, Ipswich, MA) to create a plasmid expressing CHMP4B-mEmerald ...
-
bioRxiv - Microbiology 2022Quote: ... A repair template plasmid carrying the ~1 kb of sequence immediately 5’ and 3’ to this gRNA sequence from the H99 genome was constructed using HiFi DNA Master Mix (NEB Cat#E2621) with a standard NATR cassette inserted between the two flanks ...
-
bioRxiv - Plant Biology 2024Quote: ... cDNA was A-tailed with Fermentas Klenow 3′ to 5′ exonuclease (Cat# EP0421) and ligated with adaptor oligonucleotides (NEB NEXT adaptor oligos) using Mighty Mix Ligase (Cat# TAK6023) ...
-
bioRxiv - Microbiology 2024Quote: ... A repair template plasmid carrying the ∼1 kb of sequence immediately 5’ and 3’ to this gRNA sequence from the H99 genome was constructed using HiFi DNA Master Mix (NEB Cat#E2621) with a standard HYGR cassette inserted between the two flanks ...
-
bioRxiv - Microbiology 2024Quote: ... 39 μl of each benzonase-treated lysate was combined with 5 μl of 10X NEB buffer for Protein MetalloPhosphatases (New England Biolabs, Ipswich, MA), 5 μl of 10 mM MnCl2 and 1 μl (400 units ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... before being incubated in 5% normal goat serum dissolved in PBS-TX (NGS-PBS-TX; NGS; New England BioLabs, Hitchin, Hertfordshire, UK) for a minimum of one hour at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmids were propagated in Escherichia coli NEB Turbo ((F’ proA+B+ lacIq ΔlacZM15/fhuA2 Δ(lac-proAB) glnV galK16 galE15 R(zgb-210::Tn10) TetS endA1 thi-1 Δ(hsdS-mcrB)5)) (New England Biolabs) at 37°C in lysogeny broth (LB ...
-
bioRxiv - Microbiology 2023Quote: ... and amplified with the primers (5’-CAA GAC TAG TGG AAG CGG AGC TAC TAA CTT CAG CCT GCT GAA GCA GGC TGG CGA CGT GGA GGA and 5’-NNN NAC GCG TCT AGC CTT CCC AGA CGT ACC C) using high-fidelity Phusion polymerase (NEB, Cat# M0530S). The PCR fragment was digested with BmtI and MluI ...
-
bioRxiv - Plant Biology 2023Quote: ... The up- and downstream flanks were obtained by PCR on gDNA of IPO323 with primer pairs 1&2 and 5&6 (Table S7) respectively using Q5 Hot Start High fidelity DNA polymerase (NEB, Evry, France). The hph was amplified from pCAMBIA0380 with the primers 3 and 4 (Table S7) ...
-
bioRxiv - Genetics 2023Quote: ... One microliter of T-tailed DNA adaptors diluted to 1.5 µM in water was added to 5 µl of amplicons diluted to 1/10 in water and 5 µl of 2X Blunt/TA Ligase Master Mix (New England Biolabs, Herts, UK) and incubated 30 min at 25°C for ligation ...
-
bioRxiv - Biochemistry 2023Quote: ... primers “frq segment 2F” (5’-GTGAGTTGGAGGCAACGCTC-3’) and “frq segment 2R” (5’-GTCCATATTCTCGGATGGTA-3’ were used for PCRs in combination with pCB05 digested with XhoI (NEB, Catalog # R0146S) to NruI (NEB ...
-
bioRxiv - Genetics 2023Quote: ... PCR-derived DNA fragments were generated by pairing oWS1359 (5°-TATGATTCCGATGAAGAAGAACAAGGTGGCGAAGGTGTACAATGT-iTriMix20-iTriMix20-iTriMix20-TGATTTTCTTGATAAAAAAAGATC-3°) and oWS1308 (5°-CAGCATATAATCCCTGCTTTA-3°) and pWS1728 template using a high-fidelity Q5 polymerase (New England Biolabs, Ipswich, MA). The PCR products were purified (Omega E.Z.N.A Cycle Pure kit ...