Labshake search
Citations for New England Biolabs :
2251 - 2300 of 3027 citations for 6 Hydroxy 3 nitro 2 picoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: A ligation reaction was then assembled by combining 2 μl 10x T4 DNA ligase buffer (NEB), 1 μl annealed 20 μM Index_A_XX stock ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µl 1 M DTT and 5 µl T4 polynucleotide kinase (NEB, 10 U/µl, #M0201) and incubated at 37 °C for 2 h ...
-
bioRxiv - Systems Biology 2024Quote: ... 66U/μl truncated T4 ligase 2 and 13U/μl murine RNAse inhibitor (all from NEB, USA)) were added at 25°C for 1h ...
-
bioRxiv - Systems Biology 2022Quote: ... 5’-AAAC(N)19-20-3’) by combining 1 μl of each 100 μM oligonucleotide with 1 μl of 10× T4 ligation buffer (NEB cat. no. B0202S), 6.5 μl of water ...
-
bioRxiv - Genomics 2022Quote: ... and then ‘A’ base was added to 3’ blunt ends using the A-Tailing reaction (NEBNext® UltraTM II End Repair/dA-Tailing Module, NEB, Cat. E7546). The purified A-tailed DNA was ligated with adaptors from the Ligation Sequencing Kit (SQK-LSK109 ...
-
bioRxiv - Genomics 2019Quote: ... 3 μg RNA was used to generate sequencing library by using NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, USA). PCR was carried out using Phusion High-Fidelity DNA polymerase ...
-
bioRxiv - Neuroscience 2019Quote: ... The cassette was amplified by PCR then ligated to the donor template using Gibson Assembly Master Mix (NEB, primers in Supplementary Table 3). The reaction was incubated at 50 °C for 15 minutes ...
-
bioRxiv - Plant Biology 2021Quote: ... a non-adenylated 3’ adapter was ordered for chemical synthesis from IDT™ and adenylated with the 5’ DNA Adenylation Kit (New England Biolabs® Inc.) (see Supplemental Table 4 for primers and adapters used) ...
-
bioRxiv - Cell Biology 2022Quote: Living ovaries were incubated at room temperature in SNAP solution containing 3 μM SNAP- Cell TMR-Star or SNAP-Cell 647SiR (New England BioLabs, S9105S and S9102S), 10% FCS and 0,2 mg/ml Insulin in Schneider’s medium ...
-
bioRxiv - Microbiology 2021Quote: ... The digested DNA (4 ml in total) was split into 4 aliquots and diluted in 8 ml ligation buffer (1X ligation buffer NEB 3 (without ATP), 1 mM ATP ...
-
bioRxiv - Neuroscience 2019Quote: ... We designed custom adaptors (Table S5) which were directly ligated to the 3’ ends of RNA using RNA ligase 1 (NEB Cat. No. M0437) and truncated RNA ligase KQ (NEB M0373) ...
-
bioRxiv - Zoology 2021Quote: ... a total of nine RNA libraries were prepared with 3 μg RNA using NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, USA) following manufacturer’s recommendations ...
-
bioRxiv - Plant Biology 2021Quote: ... Detection of editing in the EBE region of CsLOB1 promoter was performed by amplifying the target region (primers in Supplementary Table 3) with high fidelity DNA polymerase Q5 (New England Biolabs, Ipswich, MA, USA), followed by cloning of PCR products and sequencing.
-
bioRxiv - Microbiology 2022Quote: ... We then used 1:3 insert to vector ratio in a 1 hour Hifi assembly reaction using NEBuilder HiFi DNA Assembly kit (NEB, Cat. No. E2621). After the HiFi assembly ...
-
bioRxiv - Physiology 2024Quote: ... and PCR was performed with Flag F (caaggacgacgatgacaaagtc) + 3’OUTR (CAGAGCCAACAACGTGAGGT) primers using Q5® High-Fidelity DNA Polymerase (New England Biolabs, MA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... hereafter called Flag-SERCA2-C) were constructed from 3×Flag-SERCA2 using a Q5 Site-Directed Mutagenesis Kit (New England BioLabs, Ipswich, MA, USA). mCherry-Sec61B (Addgene ...
-
bioRxiv - Microbiology 2024Quote: ... 3 ug RNA was treated with Promega RQ1 DNase (M6101) then cleaned up with the Monarch® RNA Cleanup Kit (NEB Biolabs, T2050S) and eluted in 30 µl dH2O.
-
bioRxiv - Molecular Biology 2023Quote: ... digoxigenin-11-ddUTP was added to the 3’ end of the digested fragments using terminal transferase enzyme (New England Biolabs, Ipswich, MA, USA).
-
bioRxiv - Microbiology 2023Quote: ... The upstream and downstream PCR products were designed to have an overlapping region of sequence to promote 3-part Gibson assembly (NEB Gibson assembly kit) and primers 5b and 4 had extensions to anneal to vector pMP62 ...
-
bioRxiv - Genomics 2023Quote: ... This 17 µl of DNA solution was incubated with 3 µl digestion mixture containing 1 µl BciVI (New England Biolabs, cat. no. R0596S) and 2 µl CutSmart buffer (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: All PolD mutants (Supplementary table 3) were generated using pLB047 and a Q5 Site-Directed mutagenesis kit (E0554 New England Biolabs Inc., Ipswich MA) as described by the manufacturer ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The inserted barcoding sequences were annealed using randomized overlapping single stranded oligonucleotides by adding 3 µl of each oligonucleotide (100 µM) to 500 µl 1x 2.1 NEB-buffer (New England Biolabs, Ipswich, MA, USA, #B6002S) followed by boiling at 100 °C for 3 minutes to finally let them associate during the cooling to room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... GFP mRNA was produced in-house using the Hiscribe® T7 Quick high yield RNA synthesis kit and 3’-O-me-m7G cap analog (New England Biolabs, MA, USA) following the manufacture’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... each containing 50 ng of DNA (comprising both vector and insert at a 1:3 molar ratio) and high-concentration T4 DNA ligase (NEB Cat No. M0202T). The ligation mix was incubated at 16°C overnight and column-purified with molecular biology-grade water ...
-
bioRxiv - Microbiology 2024Quote: ... RNA was synthesized from a DNA template (Supplementary Table 3) using the HiScribe T7 High Yield RNA Synthesis Kit (NEB, Ipswich, MA, USA) and treated with DNase I (NEB ...
-
Chromosome-level assembly of Cucumis sativus cv. ‘Tokiwa’ as a reference genome of Japanese cucumberbioRxiv - Genomics 2024Quote: ... we put 3 μg of the size-selected DNA for end-repair using NEBNext FFPE DNA Repair Mix (NEW INGLAND BioLabs inc., Massachusetts, USA) and NEBNext Ultra II End Repair/dA-Tailing Module ...
-
bioRxiv - Microbiology 2020Quote: ... PCR protocols entailed an initial phase of 95° C for 3 min using Hot Start Taq polymerase (New England BioLabs Inc., Ipswich, MA, USA), followed by 35 cycles at 50°C and 52°C annealing temperatures for 16S and ITS amplicons respectively ...
-
bioRxiv - Neuroscience 2020Quote: ... Sequencing libraries were generated from a total amount of 3 μg RNA per sample using NEBNext® Ultra™ RNA Library Prep Kit for Illumina® (NEB, USA) following manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2021Quote: ... 500 μl of lysed cells were transferred to a tube containing 4.5 ml of digestion mix (1X NEB 3 buffer, 1% triton X-100) and 100 μl of the lysed cells were transferred to a tube containing 0.9 ml of digestion mix ...
-
bioRxiv - Microbiology 2024Quote: ... 5’-GCT GCG TTC TTC ATC GAT GC-3’) were chosen with barcodes for PCR amplification using Phusion® High-Fidelity PCR Master Mix (New England Biolabs, Ipswich, MA, USA). The PCR products were then mixed at equal density ratios and purified with a Gel extraction kit (QIAGEN ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 100 ng of DNA was cleaved with PstI HF and MseI restrictases in CutSmart® buffer (New England Biolabs; 3 hours at 37°C). P1 and P2 barcoded adapters corresponding to the restriction site of the enzymes were ligated immediately afterwards with T4 ligase (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were resuspended in 50 mL buffer 3 (20mM KPi pH 7.4, 1.2M Sorbitol, 10 mM ribonucleoside vanadyl complex (NEB S1402S, pre-warmed at 65 °C), 0.08mg/ml Zymolyase-20T (Amsbio 326921) ...
-
bioRxiv - Genomics 2022Quote: ... and for the synthesis of the second strand of cDNA was used the Klenow fragment 3’-5’ exo (New England Biolabs Inc., Ipswich, MA, USA), following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... 0.2 μM primers (primer sequences are presented in Table S1) and 2 × PCR Master mix (M0482S, NEB), with the following cycling parameters ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Extracted RNA was treated with 2% RNase-free DNase I (New England BioLabs Japan Inc., Tokyo, Japan) at 37°C for 40 minutes and purified by phenol/chloroform extraction and ethanol precipitation.
-
bioRxiv - Molecular Biology 2020Quote: ... cells were incubated with 2 nM HaloTag-JF549 and 5 nM SNAP-Cell® 647-SiR (NEB) before imaging.
-
bioRxiv - Molecular Biology 2021Quote: ... Samples were then incubated at 45 °C for 2 hr with 5 μL of Proteinase K (NEB) in the presence of 40 mM EDTA (pH 8.0 ...
-
bioRxiv - Genomics 2022Quote: ... 7 μl PEG 8000 (17.5% final) and 1 μl of T4 RNA ligase 2 KQ (NEB, M0373L) in 1X T4 RNA ligase buffer ...
-
bioRxiv - Genomics 2019Quote: ... by adding 20 µL of ligation mix [2 µL of [10X Taq DNA ligase buffer (NEB B0208S), 0.25 µL Taq DNA ligase (NEB M0208S) ...
-
bioRxiv - Genomics 2019Quote: ... DNA fragment size was determined by running 2 µL of DNA along with low molecular ladder (NEB) on a 2% agarose gel.
-
bioRxiv - Microbiology 2019Quote: ... PCR was performed on a plasmid template using the Q5 High-fidelity 2× Master Mix (NEB, M0492L), with primers at final concentration of 500nM ...
-
bioRxiv - Microbiology 2021Quote: ... total RNAs were extracted from Caco-2 cells and followed by mRNA purification (Oligo dT beads, NEB). The mRNAs were fragmented and converted into double-stranded DNA by reverse transcription and then second-strand synthesis (NEB) ...
-
bioRxiv - Biochemistry 2020Quote: ... 8 μL of the de-phosphorylated DNA was incubated with 2 μL T4 Polynucleotide Kinase (NEB M0203S), 3 μL γ32P-dATP (Perkin Elmer) ...
-
bioRxiv - Cancer Biology 2020Quote: ... The purified PCR products were denatured and reannealed in NEBuffer 2 (New England BioLabs, Ipswich, MA, USA), using a thermocycler ...
-
bioRxiv - Neuroscience 2021Quote: ... 50mM Sodium Butyrate) and incubated in a 37C water bath with 2 microliters Micrococcal Nuclease enzyme (NEB) for eight minutes ...
-
bioRxiv - Biochemistry 2020Quote: 1 μg of N protein was dissolved in 36 μL H218O and 2 μL 10x glycobuffer (NEB). To this solution 2 μL PNGase F was added and the reaction mixture was incubated at 37 °C for 16 h ...
-
bioRxiv - Plant Biology 2021Quote: ... Amplification products were evaluated in 2 % agarose with Low Molecular Weight DNA Ladder (New England BioLabs, Ipswich). Residual primers and nucleic acids were removed from PCR reactions with Exonuclease I (New England BioLabs ...
-
bioRxiv - Microbiology 2020Quote: ... PCR reactions were performed with the Q5 Hot Start High-Fidelity 2× Master Mix (New England Biolabs) with 100 ng of genomic DNA ...
-
bioRxiv - Genomics 2021Quote: ... and NEBNext® Multiplex Oligos for Illumina® Index Primers Set 1 and 2 (NEB #E7335S, #E7500S), following the manufacturer’s instructions with minor modifications ...
-
bioRxiv - Microbiology 2020Quote: ... The reverse transcription reaction (20 μL) contained 2 μL 10x M-MulV buffer (B0253S, New England Biolabs), 1 μL of 50 μM Oligo 18 dT (SO132 ...