Labshake search
Citations for New England Biolabs :
2201 - 2250 of 8828 citations for QuantiChrom Iron Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... The samples were converted for sequencing with the NEBNext enzymatic methyl-seq kit (NEB) and sequenced at the University of Minnesota Genomics Center ...
-
bioRxiv - Microbiology 2022Quote: ... gDNA-free RNA was purified using Monarch RNA Clean-up Kit (New England Biolabs) and visualised on an agarose gel.
-
bioRxiv - Microbiology 2022Quote: ... and cloned into a pVFT1S expression vector using a HiFi DNA Assembly kit (NEB). Both nsp10 and nsp14 contained an N-terminal 6x-His tag ...
-
bioRxiv - Genomics 2022Quote: ... and poly-A tailed using the HiScribe™ T7 ARCA mRNA Kit (NEB, E2065S) with 50% supplement of 5-Methyl-CTP and Pseudo-UTP (Jena Biosciences) ...
-
bioRxiv - Biochemistry 2022Quote: ... CENP-U250-418) were generated using a HiFi DNA assembly kit (New England Biolabs).
-
bioRxiv - Cancer Biology 2022Quote: ... the library concentration was qPCR measured by NEBNext Library Quant Kit (New England BioLabs) using QuantStudio 5 Real-Time PCR Systems (Thermo Fisher ...
-
bioRxiv - Microbiology 2022Quote: HEV and FCV transcripts were generated using the HiScribe T7 ARCA mRNA kit (NEB) using 1 μg of linearised plasmid template following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... for both RubPro and RubProHel using Q5 Site-directed Mutagenesis Kit (New England BioLabs). The forward and reverse primer used were TCCCAACACTGCGTGGCTGAGAGCCGCCG and TCGAGTTCCCCGCCCCTT respectively ...
-
bioRxiv - Microbiology 2022Quote: ... The fragment was gel purified using Monarch DNA Gel Extraction Kit (New England Biolabs), and Sanger sequencing was performed using BigDye Terminator v3.1 and either the forward or the reverse primer ...
-
First De novo whole genome sequencing and assembly of mutant Dendrobium hybrid cultivar ‘Emma White’bioRxiv - Genomics 2022Quote: ... A DNA sequencing libraries were prepared using a DNA library preparation kit (NEB NextUtra) and tested with Agilent Tapestation for quality validation ...
-
bioRxiv - Cancer Biology 2022Quote: ... First-strand cDNA synthesis was performed using LunaScript RT SuperMix Kit (NEB, cat. E3010S). qPCR was performed on a QuantStudio 3 or StepOnePlus real-time PCR machine using TaqMan Fast Advanced Master Mix (Applied Biosystems ...
-
bioRxiv - Genomics 2021Quote: ... The nucleosomes were assembled using the EpiMark® Nucleosome Assembly Kit (New England Biolabs) following the kit’s protocol.
-
bioRxiv - Genomics 2021Quote: ... we prepared 36 libraries using the NEBNext Ultra ChIP-seq kit (New England Biolabs) and sequenced libraries on the Illumina HiSeq 2500 sequencer using the 2×150-bp mode ...
-
bioRxiv - Microbiology 2020Quote: ... and poly(A)+ mRNA selected using the NEB Magnetic mRNA Isolation Kit (NEB S1550S).
-
bioRxiv - Microbiology 2021Quote: ... followed by purification with the Monarch PCR and DNA Cleanup Kit (New England Biolabs). The purified products were submitted for Sanger sequencing at Laragen ...
-
ACE2-lentiviral transduction enables mouse SARS-CoV-2 infection and mapping of receptor interactionsbioRxiv - Microbiology 2021Quote: ... cDNA was synthesized using ProtoScript II First Strand cDNA Synthesis Kit (New England Biolabs) and qPCR performed using iTaq Universal SYBR Green Supermix (Bio-Rad ...
-
bioRxiv - Developmental Biology 2021Quote: ... Libraries were prepared using NEBNext Ultra Directional RNA Library Prep Kit for Illumina (NEB) (zebrafish ...
-
bioRxiv - Molecular Biology 2019Quote: ... and amplified/indexed by PCR with the NEBNext DNA Library Prep Kit (NEB E6040). Samples were sequenced using a NextSeq 500/550 75 cycle kit (Illumina TG-160-2005) ...
-
bioRxiv - Genomics 2020Quote: ... DNA was then eluted and purified for library preparation with NEBNext Ultra kits (NEB).
-
bioRxiv - Genomics 2020Quote: ... The libraries were prepared using the NEBNext Ultra II DNA Library Prep Kit (NEB) followed by NG sequencing using the Illumina HiSeq X Ten system ...
-
bioRxiv - Immunology 2021Quote: ... CD4 domain deletion mutants were generated using the Q5 Site-Directed Mutagenesis Kit (NEB) according to the manufactureŕs protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... The tags were removed using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs) to generate wild-type ...
-
bioRxiv - Molecular Biology 2020Quote: Some cloning reactions were carried out with NEBuilder HiFi DNA assembly cloning kit (NEB) while others were made by conventional means ...
-
bioRxiv - Immunology 2020Quote: The PCR products were cleaned using the Monarch® DNA Gel Extraction Kit (NEB), and 3’ end A-overhangs were added by NEBNext® dA-Tailing Module (NEB) ...
-
bioRxiv - Neuroscience 2020Quote: ... In vitro transcription was performed using HiScribe Quick T7 kit (New England Biolabs #E2050S) following the manufacturer’s directions and incubating for 3 hr at 37°C ...
-
bioRxiv - Immunology 2020Quote: ... cDNA synthesis and amplification were performed with Next Ultra RNA Library Preparation Kit (NEB). Libraries were sequenced on a HiSeq3000 (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR was performed using the Luna Universal One-Step RT-qPCR Kit (NEB) in an Applied Biosystems QuantStudio 7 thermo-cycler ...
-
bioRxiv - Microbiology 2021Quote: ... This preparation was conducted with the Monarch Total RNA Miniprep Kit (New England Biolabs) following the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2022Quote: ... 900 ng RNA was depleted of rRNA using the NEBNext rRNA Depletion kit (NEB). RNA-seq libraries were prepared from an equal amount of ribo-depleted RNA using the NEBNext Ultra II Directional RNA Library Prep kit ...
-
bioRxiv - Microbiology 2022Quote: ... The DNA fragments were assembled using NEBuilder HiFi DNA Assembly kit (New England Biolabs) and the plasmid was transformed into E ...
-
bioRxiv - Microbiology 2022Quote: ... Illumina libraries were prepared with NEBNext Ultra DNA Library Prep Kit (New England Biolabs). DNA samples were fragmented in a Covaris instrument and sequenced on an Illumina MiSeq device as paired-end reads ...
-
bioRxiv - Molecular Biology 2022Quote: ... sequencing libraries were generated using NEBNext Ultra RNA Library Prep Kit for Illumina (NEB). Library quality was assessed using the Ilumina Bioanalyser 2100 system (Agilent Technologies) ...
-
bioRxiv - Genomics 2022Quote: ... ChIP-seq libraries were constructed using the NEBNext Ultra II DNA Kit (NEB, E7645).
-
bioRxiv - Genomics 2022Quote: ... Sequencing libraries were prepared using NEBNext Ultra II RNA library prep kit (NEB E7770S) and sequenced by the Illumina NovaSeq 6000 with 100bp paired end reads ...
-
bioRxiv - Systems Biology 2022Quote: ... PCRs were performed using the Luna® Universal One Step RT-qPCR Kit (NEB) in a ThermoFisher Quantstudio 3 instrument ...
-
bioRxiv - Systems Biology 2022Quote: ... the probes were purified with the Monarch® RNA Cleanup Kit (500 μg, NEB).
-
bioRxiv - Microbiology 2022Quote: ... One reaction of NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB #E7645) was used for 1 μg genomic DNA input ...
-
bioRxiv - Cell Biology 2022Quote: ... Point mutations were introduced via Q5 Site-Directed Mutagenesis Kit (M0554S; New England Biolabs).
-
bioRxiv - Biochemistry 2022Quote: ... The N-terminal deletions were made using the HiFi DNA cloning kit from NEB to excise portions of the N-terminus of the gene ...
-
bioRxiv - Genetics 2022Quote: ... PCR products were extracted with the Monarch DNA Gel Extraction Kit (New England Biolabs) after running on an agarose gel ...
-
bioRxiv - Synthetic Biology 2022Quote: ... First strand cDNA synthesis was performed using the Protoscript cDNA kit (NEB, Waltham, MA) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... NS5A mutations were constructed using Q5 Site-Directed Mutagenesis Kit (New England BioLabs; E0554S) and cloned into either mSGR-luc-JFH-1 or mJFH-1 via the BamHI/AfeI restriction sites ...
-
bioRxiv - Cancer Biology 2022Quote: ... Resulting libraries were prepared using NEBNext Ultra II Directional RNA Kit (New England BioLabs). Samples were run on Illumina NovaSeq 6000 (SCR_01638 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Poly-A RNA enrichment was performed using NEBNext Poly(A) kit (New England BioLabs). Fragments were end-modified with adaptors using NEBNext Multiplex Oligos for Illumina Set 2 (New England BioLabs) ...
-
bioRxiv - Microbiology 2019Quote: ... mutations were generated by using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs).
-
bioRxiv - Biophysics 2019Quote: ... The samples were then purified with the Monarch® PCR & DNA Cleanup Kit (NEB) and eluted in 10 μl ...
-
bioRxiv - Microbiology 2019Quote: ... and TS-TIGR4) with the NEBNext Ultra RNA Library Prep Kit (New England Biolabs) using default protocols ...
-
bioRxiv - Microbiology 2019Quote: ... the 3’ adapter-ligated DNA fragments were adenylated using 5’ DNA Adenylation Kit (NEB) in a 20-μl reaction following the manufacturer’s recommendations ...
-
bioRxiv - Genetics 2020Quote: ... sequencing using NEBNext UltraII DNA library Prep Kit for Illumina (New England BioLabs, Inc) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: Libraries were prepared using either a NEBNext DNA Ultra II kit (New England BioLabs) or an Illumina TruSeq DNA Sample Prep Kit (Table S5) ...