Labshake search
Citations for New England Biolabs :
2201 - 2250 of 2641 citations for Porcine Circovirus 2 PCV2 Protein since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: Cloning of the plf gene clusters and plfG and papG genes encoding the different classes of adhesins were obtained by PCR amplification using specific primers (Table 2) and Q5 High Fidelity-DNA polymerase (New England Biolabs [NEB]). The A-Tailing Kit (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein expression was induced with 0.3 mM IPTG for 2 hours at 37°C and recombinant MBP-rabaptin5 was purified with an amylose resin (New England Biolabs) according to manufacturs instructions and dialysed against lysis buffer (20 mM Tris-HCl ph7.4 ...
-
bioRxiv - Molecular Biology 2021Quote: ... An adenylated adaptor was ligated to the 3’-end of the captured transcripts (Supplementary Table 3) by using a mixture of T4 RNA ligase and truncated T4 RNA ligase 2 (ThermoFisher Scientific and NEB), which served as a template for the reverse transcription primer (Supplementary Table 3) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Samples were heated for 1 minute at 100°C followed by the addition of 2 μL of peptide N-glycosidase F (New England Biolabs) to release the N-glycans ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA encoding aa 1-862 of mouse ZO-1 was amplified by PCR using KOD-Plus-Ver.2 DNA polymerase and subcloned into pMAL-cRI (New England BioLabs). Expression vectors for MBP-fusion proteins of PDZ1 ...
-
bioRxiv - Genomics 2020Quote: ... followed by ligation of 3’ ends with pre-adenylated DNA adapters (App-GATCGTCGGACTGTAGAACTCTGAAC/3InvdT/) using T4 RNA Ligase 2 truncated K227Q (NEB) in absence of ATP ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products were generated with the primers listed in Supplementary Table 2 using HF Phusion DNA polymerase (New England Biolabs).
-
bioRxiv - Microbiology 2020Quote: ... The ligation mixture was then used in a PCR reaction with primers 2569/2570 (Table 2) and Phusion DNA polymerase (New England BioLabs). PCR was carried out in 50 μl reactions for 3 min at 98°C followed by 30 cycles of 1 min at 98°C ...
-
bioRxiv - Microbiology 2020Quote: High throughput sequencing libraries were prepared using RNA isolated from total RNA or PAR-CLIP samples using the NEBNext Multiplex Small RNA Library Prep Set for Illumina (Set 2; cat# E7580, New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... A 2-micron Ura3-selective plasmid was constructed from three DNA fragments using HiFi DNA Assembly Master Mix (New England Biolabs) for cloning ...
-
bioRxiv - Genomics 2021Quote: ... 10% Dextran sulfate Sigma D8906; 0.02% BSA Ambion AM2616; 1 mg/ml E.coli tRNA Sigma R1753; 2 mM Vanadyl-ribonucleoside complex NEB S1402S; 2XSSC) containing diluted probes and incubated over night at 30°C ...
-
bioRxiv - Genomics 2021Quote: ... The isolated mRNA was then used to prepare sequencing libraries using NEBNext Ultra II Non-directional RNA Library Prep Kit for Illumina and NEBNext Multiplex Oligos for Illumina (Index sets 1 and 2) (NEB). Next ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Each PCR amplification product was digested overnight at 37 °C with 2 μl of CutSmart® uffer (New England Biolabs) and 0.2 μl of AccI enzyme (10 U/mL ...
-
bioRxiv - Bioengineering 2021Quote: ... was carried out (25 ng linearized vector, 10 ng purified insert, 10 µL 2 x Gibson Assembly Master Mix (New England BioLabs) and up to 20 µL H2O were mixed and incubated at 50°C for 1 hour) ...
-
bioRxiv - Cell Biology 2021Quote: ... using 35 cycles with an annealing temperature of 60 °C (see table 2 for list of primers) and cloned by Gibson Assembly Cloning Kit (EE5510S, NEB). All primers were designed using SnapGene (GSL Biotech LLC ...
-
bioRxiv - Microbiology 2020Quote: ... each reaction tube of 20 µl contained 10 µl of Q5 High-Fidelity 2× Master Mix (New England BioLabs Inc.), 20 pmol of forward and reverse primer ...
-
bioRxiv - Systems Biology 2023Quote: ... and used as template for the 2nd PCR where Illumina barcodes were added by NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1 and 2) (New England Biolabs). PCR products were purified using AMPure XP beads (BECKMAN COULTER) ...
-
bioRxiv - Microbiology 2023Quote: ... Samples were boiled for 10 min and 2 μL of 20 mg/ml proteinase K (New England Biolabs, Cat. #P8107S) were added ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2.7 µl of the sample of eluted extension products were included in a 10 µl T4 RNA ligase 2 truncated KQ reaction (1× T4 RNA ligase buffer (NEB), 2 µM IllLigBio adapter pre-adenylated using a 5’ adenylation kit (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The SNAP-tagged histones neosynthesized during the chase time were then pulse-labelled by incubating cells with 2 μM of the red-fluorescent SNAP reagent SNAP-cell TMR star (New England Biolabs) for 15 min at 37°C ...
-
bioRxiv - Genetics 2022Quote: ... 2 μg of DNA was digested with 50 units of DpnII and 5 μL NEBuffer™ DpnII (NEB, cat #R0543L), in a total volume of 50 μL ...
-
bioRxiv - Biochemistry 2023Quote: Transcription reactions were prepared at room temperature in 20 µL transcription buffer (40 µM Tris-HCl pH 8, 5 mM DTT, 10 mM MgCl2) with 2 mM NTP’s (NEB, N0450S) and 40 U/µL RNasin™ Plus (Promega ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.5 mM each of forward and reverse primers (Supplemental Table 2) and 0.5 U Phusion® HF DNA polymerase (NEB) in a reaction volume of 25 μl ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were generated by 7-9 rounds of PCR amplification using NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L), purified using SPRIselect reagent kit (Beckman Coulter ...
-
bioRxiv - Genetics 2023Quote: ... we treated the glands with 0.1% Triton X-100 for 2 minutes prior to adding 100 ug/mL RNase A (NEB #T3018L) and performed a 1 hour incubation at RT (24 ...
-
bioRxiv - Cell Biology 2023Quote: ... The small RNAs were then ligated to a 3’ adaptor (5’ rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’; IDT) by T4 RNA ligase 2(NEB). The 5’ adaptor containing 6 nt barcode was ligated using T4 RNA ligase 1 ...
-
bioRxiv - Cell Biology 2023Quote: ... all strains were generated by the S1/2/3/4 homologous recombination PCR integration method (Janke et al., 2004) using a Q5 PCR Kit (NEB). S1-S2 primers was used to knock out endogenous proteins ...
-
bioRxiv - Cell Biology 2023Quote: ... grk-2 cDNA corresponding to the C-terminal GRK-2 fragment was amplified from a mixed-stage N2 cDNA library using Q5 high-fidelity DNA polymerase (NEB) with gene-specific primers ...
-
bioRxiv - Genomics 2023Quote: ... ninety-six 20 μl ePCR reactions were performed using 0.01 fmol of pooled oligos with NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541S). Each 20 μl PCR mix was combined with 40 μl of oil-surfactant mixture (containing 4.5 % Span 80 (v/v) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were generated by 5-7 rounds of PCR amplification using NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L), purified using SPRIselect reagent kit (Beckman Coulter ...
-
bioRxiv - Cell Biology 2023Quote: ... the repair vector GW209_pCRIS-PITChv2-C-dTAG-Puro (BRD4) (2 μg) was digested with MluI-HF (New England Biolabs; #R3198) in Cutsmart Buffer for 1 hour ...
-
bioRxiv - Bioengineering 2023Quote: ... The 2 pairs of ends were then ligated simultaneously to the linearized plasmid using T4 DNA Ligase (New England Biolabs:M0202) at 2 U/pmol DNA ends in 1x T4 ligase buffer (provided with enzyme) ...
-
bioRxiv - Molecular Biology 2023Quote: ... in 100 µL MNase reaction mix (87 µL ddH2O, 10 µL 10x MNase buffer, NEB, 1 µL 100x BSA, 2 µL 2000 U/µL MNase, NEB). Digests were centrifuged (5 min ...
-
bioRxiv - Microbiology 2023Quote: ... concisus for 2 h at 37°C in presence of 0.4 mM S-Adenosylmethionine (SAM, New England Biolabs, Ipswich, MA). After methylation ...
-
bioRxiv - Molecular Biology 2023Quote: ... or MnlI was at 37 °C for 2 h (EcoRI-HF) or 3 h (HhaI or MnlI) in rCutSmartTM Buffer (NEB). Nuclease S1 (Boehringer Mannheim ...
-
bioRxiv - Microbiology 2023Quote: ... 3 μL of 5’ adenylated linkers (Supplementary Table 4) were added (33 pmol/μL) along with 1 μL T4 RNA ligase 2 truncated (New England BioLabs) and incubated at 25 °C for 2.5 hours ...
-
bioRxiv - Microbiology 2023Quote: ... Boiled tRNA was mixed with 12 μL PEG buffer mix (10 μL 50% PEG8000, 2 μL 10 × buffer B0216S; New England Biolabs). 3 μL of 5’ adenylated linkers (Supplementary Table 4 ...
-
bioRxiv - Neuroscience 2023Quote: ... mRNA was eluted from the oligo-dT beads and fragmented by incubating with the First Strand Synthesis Reaction buffer and Random Primer Mix (2×) from the NEBNext Ultra II Directional Library Prep Kit for Illumina (#NEBE7760; New England Biolabs) for 15Lmin at 94°C ...
-
bioRxiv - Genomics 2023Quote: ... followed by the addition of 22 µL of ligation mix (20 µL quick ligase buffer and 2 µL of quick ligase, NEB) and incubation at 25°C for 10 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... Clarified lysate was applied to Glutathione Sepharose 4B affinity resin (1 ml bed volume per 2 l culture; New England Biolabs), and incubated with rotation for
-
bioRxiv - Genomics 2023Quote: ... and washed twice with 2 mL of CLB containing Superase-In and 1% v/v of 20 mg/mL molecular grade BSA (NEB). After the final wash ...
-
bioRxiv - Biochemistry 2023Quote: ... Reactions with UDP-MurNAc-80mer RNA contained 2 µg RNA and products were purified using the Monarch RNA Cleanup Kit (NEB).
-
bioRxiv - Molecular Biology 2022Quote: ... The end-repaired cDNA was ligated with 2 μL barcoded adaptor (100-466-000, Pacific Biosciences) with T4 DNA Ligase (M0202, New England Biolabs) in 50 μL reaction volume at room temperature for 1 hour ...
-
bioRxiv - Molecular Biology 2022Quote: ... and a double HA tagged NanoLuc to the genomic locus was reintroduced into MluI linearized pCRIS-PITChv2 vectro backbone with NEBuilder 2× HiFi assembly (New England Biolabs)51.
-
bioRxiv - Molecular Biology 2022Quote: ... This PCR product was then introduced in MluI linearized pCRIS-PITChv2 vector via NEBuilder 2× HiFi assembly (New England Biolabs). Primers containing 20 to 22 bp homology regions corresponding to the genomic locus 5’ and 3’ of the sgRNA cleavage were used to PCR this cassette ...
-
bioRxiv - Immunology 2022Quote: ... the pools of insert 1 and the pools of insert 2 were assembled using NEBuilder HiFi DNA Assembly Master Mix (NEB). The assembled product was bead-purified using Sera-Mag SpeedBeads (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2023Quote: ... Libraries were size selected for cDNA target fragments of 300 bp on 2% Low Range Ultra Agarose followed by PCR amplified using Phusion DNA polymerase (NEB) for 15 PCR cycles ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 µl from the PCR product were circularized using 1 µl T4 DNA ligase and 2 µl ligation buffer 10x (NEB) in a final volume of 20 µl ...
-
bioRxiv - Biochemistry 2024Quote: Fab Fragments were generated by taking .5 mg of IgG and digesting with 2 µL of Lys C (NEB#P8109S) at 37℃ ...
-
bioRxiv - Biochemistry 2024Quote: ... After 30 mins the samples were placed on ice and 2 μl loading dye (Purple gel loading dye, no SDS, B7025 New England Biolabs) was added prior to loading 12 μl onto a 1.5% 15 x 15 cm 100 ml 0.5X TB agarose gel ...