Labshake search
Citations for New England Biolabs :
2151 - 2200 of 9366 citations for Rat Alanine Glyoxylate Aminotransferase AGXT ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... Mutants of the bGSDM genes were constructed using Q5 Site-directed Mutagenesis kit (NEB). The Runella bGSDM ...
-
bioRxiv - Developmental Biology 2020Quote: ... Library concentration was determined by NEBNext Library Quant Kit for Illumina (New England Biolabs). Paired end sequencing (76 cycles ...
-
bioRxiv - Microbiology 2022Quote: ... Connecting the DNA segments was performed using the NEBuilder HiFi DNA Assembly Kit (NEB) or Ligation high Ver.2 (TOYOBO) ...
-
bioRxiv - Molecular Biology 2022Quote: ... the FLuc Control Template from the HiScribe T7 high yield RNA synthesis kit (NEB) was in vitro transcribed and purified as described the linearized pTXB1 vector.
-
bioRxiv - Neuroscience 2022Quote: ... were produced by using in vitro transcription HiScribe™ T7 ARCA Kit (NEB, E2060S) following the manufacturer instructions ...
-
bioRxiv - Microbiology 2022Quote: ... the PCR product was transcribed using HiScribe T7 High Yield RNA Synthesis Kit (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... Bromodomain mutants were generated using the Q5 site-directed mutagenesis kit (New England Biolabs) and each mutation was confirmed through DNA sequencing ...
-
bioRxiv - Neuroscience 2021Quote: ... sequencing using NEBNext UltraII DNA library Prep Kit for Illumina (New England BioLabs, Inc) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... and the digestion product was purified using Monarch PCR & DNA Cleanup Kit (NEB, T1030S). Following the preparation of both the backbone vector and insert ...
-
bioRxiv - Molecular Biology 2021Quote: ... DNA purification was performed using the Monarch PCR & DNA Cleanup Kit (NEB, Ipswich, USA). Libraries were then amplified and purified before being size selected using magnetic AMPure XP Beads (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2021Quote: ... followed by library preparation with NEBNext Ultra II DNA Library Prep Kit Illumina (NEB). The library was sequenced on HiSeqV4 (Illumina ...
-
bioRxiv - Molecular Biology 2021Quote: ... ChIP-seq libraries were prepared using NEBNext Ultra DNA Library Prep Kit Illumina (NEB) and sequenced on HiSeqV4 (Illumina ...
-
bioRxiv - Molecular Biology 2020Quote: ... Libraries were prepared using the NEBNext UltraII DNA library prep kit for Illumina (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... Other constructs were created using a Gibson assembly cloning kit (E5510; New England Biolabs). All DNA fragments were inserted into the GFP vector backbone pPD95.77 ...
-
bioRxiv - Molecular Biology 2021Quote: ... mRNAs were isolated from total RNA using a Magnetic mRNA isolation kit (S1550S, NEB), and libraries were prepared using a NEXTflex Rapid directional RNA-seq kit (5138-08 ...
-
bioRxiv - Molecular Biology 2021Quote: ... In vitro translation was carried out in 10 µL using the PURExpress kit (NEB) according to the commercial protocol in the presence of a mix of 32P-radiolabeled cspA mRNA (200000 cpm/µL ...
-
bioRxiv - Molecular Biology 2021Quote: ... WGS libraries were generated using the NEBNext Ultra II DNA Library Prep kit (NEB) according to manufacturer’s recommendation with 1µg input material ...
-
bioRxiv - Genomics 2022Quote: ... Guide RNAs were in-vitro synthesized using Engen gRNA synthesis Kit (New England Biolabs) according to the manufacturer instruction with synthesis of the double stranded DNA template and transcription of RNA in a single reaction ...
-
bioRxiv - Genomics 2022Quote: ... Guide RNAs were then purified using Monarch RNA Cleanup Kit (New England Biolabs T2040L) per manufacturer instructions.
-
bioRxiv - Evolutionary Biology 2022Quote: ... Libraries were constructed using NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB) with each pool indexed with a unique dual barcode (NEBNext Multiplex Oligos for Illumina ...
-
bioRxiv - Genomics 2020Quote: ... we used the NEBNext Ultra II FS DNA library kit (New England Biolabs, Inc); the initial enzymatic shearing step was accomplished via 10 minutes of incubation at 37°C ...
-
bioRxiv - Genomics 2020Quote: ... mRNA isolation module in conjunction with their Ultra II RNA directional kit (NEB, E7760) was used to generate libraries for sequencing ...
-
bioRxiv - Immunology 2021Quote: ... cDNA library was prepared using NEBNext Ultra RNA Library Prep Kit for Illumina (NEB) and sequenced on NextSeq 500 System (Illumina ...
-
bioRxiv - Genomics 2020Quote: ... and NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, MA, USA) was used to generate sequencing libraries ...
-
bioRxiv - Molecular Biology 2021Quote: ... Mutant protein expression vectors were generated using the Q5 Mutagenesis Kit (New England BioLabs) and proteins overexpressed and purified the same as wild-type.
-
bioRxiv - Molecular Biology 2021Quote: ... 20 μg of samples were processed using a commercially available kit (New England Biolabs), PrPC detection was performed using the monoclonal anti-PrPC antibody POM2 as described above ...
-
bioRxiv - Molecular Biology 2021Quote: ... All minigene mutations were introduced via Q5 Site-Directed Mutagenesis Kit (New England Biolabs). The nine mutations from eight patients in Orlando et al ...
-
bioRxiv - Microbiology 2020Quote: ... The sgRNAs were prepared using the EnGen™ sgRNA Synthesis Kit (New England BioLabs), along with a sg control (g-control- CATCCTCGGCACCGTCACCC) ...
-
bioRxiv - Cancer Biology 2019Quote: ... site-directed mutagenesis was performed using Q5 Site-Directed Mutagenesis Kit (New England BioLabs) using the primers ACTTGGACGAGCTATTGGAGAAGGC ...
-
bioRxiv - Genomics 2019Quote: ... DNA was repaired and dA-tailed using PreCR and FFPE kits (New England Biolabs) and cleaned with Ampure XP beads (Beckman Coulter) ...
-
bioRxiv - Cell Biology 2019Quote: ... The mutations were made using the Q5 site directed mutagenesis kit (New England Biolabs). The constructs contained the promoter from the maternal alpha tubulin gene ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The parts were assembled using the NEB HiFi DNA Assembly kit (New England Biolabs) with an incubation time of one hour at 50°C ...
-
bioRxiv - Microbiology 2019Quote: ... Monarch® PCR & DNA Cleanup Kit (5 μg) (New England Biolabs GmbH; Ipswich, USA), or innuPREP DOUBLEpure Kit (Analytik Jena ...
-
bioRxiv - Microbiology 2019Quote: ... The PCR products were fragmented randomly with the NEBNext® dsDNA fragmentase kit (NEB) and then purified with the AMPure® XP Beads kit (Beckman Coulter ...
-
bioRxiv - Developmental Biology 2019Quote: Pceh-23_L::acy-2(genomic) was generated with a Gibson assembly cloning kit (NEB) by assembly of the following two DNA fragments ...
-
bioRxiv - Developmental Biology 2019Quote: Pacy-2::acy-2 genomic was generated with a Gibson assembly cloning kit (NEB) by assembly of the following two DNA fragments ...
-
bioRxiv - Cell Biology 2019Quote: ... and capped mRNA was synthesised using the T7 ARCA mRNA kit (New England Biolabs) according to the user’s manual and resuspended in water ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... The proA** expression plasmid was constructed using the Q5 Site-Directed Mutagenesis Kit (NEB).
-
bioRxiv - Molecular Biology 2019Quote: ... Ribosomal RNA depletion was performed using the NEBNext rRNA depletion kit (New England Biolabs). First strand synthesis was achieved using SuperScript III reverse transcriptase (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... random hexamer and the Protoscript II First Strand cDNA Synthesis Kit (New England Biolabs). A specific set of primers (Table S10 ...
-
bioRxiv - Genomics 2019Quote: ... followed by library preparation (NEBNext Ultra II DNA Library prep Kit, New England Biolabs), adaptor ligation and index barcoding (Sanger 168 tag set) ...
-
bioRxiv - Molecular Biology 2019Quote: ... If noted PCR products were used to synthesize RNA using T7 polymerase kit (NEB), purified using NEB RNA purification kit and equal amount of purified RNA was used for in vitro reaction (1 - 3ug) ...
-
bioRxiv - Pathology 2020Quote: ... The sequencing library was generated using the Illumina RNA Library Prep Kit (NEB, USA) following the manufacturer’s recommendation ...
-
bioRxiv - Microbiology 2019Quote: ... Library preparation was performed using the NEBNext Ultra Directional RNA Library Prep Kit (NEB), including double-AMPure bead (Beckman Coulter ...
-
bioRxiv - Microbiology 2019Quote: ... NEBNext® Ultra™ Directional RNA library prep kit for Illumina® (NEB E7760) and NEBNext® Multiplex oligos for Illumina® (NEB E7335S) ...
-
bioRxiv - Cell Biology 2019Quote: ... ChIRP libraries are constructed using the NEBNext DNA library preparation kit (New England Biolabs).
-
bioRxiv - Microbiology 2021Quote: ... The PCR fragments were stitched together using the Gibson assembly kit (NEB CN# E2611S) following manufacturer’s instructions to yield pJV204 ...
-
bioRxiv - Genetics 2021Quote: ... and the plasmid DNA was extracted using the Monarch® Plasmid Miniprep Kit (NEB). The presence of the correct inserts was done by performing a PCR reaction using the same primers as for the initial target amplification and using the corresponding plasmid DNA as a template.
-
bioRxiv - Genomics 2021Quote: Libraries were prepared with the NEBNext Ultra II FS Library Preparation Kit (NEB, E6177S) according to manufacturer instructions in most steps ...
-
bioRxiv - Genomics 2020Quote: ... Sequencing libraries were prepared using the NEBNext Ultra DNA Library Prep kit (E7370; NEB) according to the manufacturer’s instructions and submitted for paired-end Illumina sequencing ...