Labshake search
Citations for New England Biolabs :
2101 - 2150 of 3291 citations for 7 METHYL PHENAZINE 1 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: The GCG1/SUT098 FPR plasmid was digested with AvrII and BglII (1 U per µg plasmid, NEB) restriction enzymes to excise the NatMX6 cassette ...
-
bioRxiv - Genomics 2021Quote: ... and resuspended in 1 x DPBS with 0.4 mg/ml bovine serum albumin (# 74719, New England Biolabs) at approximately 1000 cells/µl ...
-
bioRxiv - Genomics 2021Quote: ... 8.5 µL of this phosphorylated product was combined with 1 µL of 10X T4 ligase buffer (NEB) and 0.5 µL of T4 DNA ligase (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... The primary antibodies used in this study were rabbit anti-GLuc 1:2,000 (E8023S, New England Biolabs), rabbit anti-epidermal growth factor receptor (EGFR) ...
-
bioRxiv - Genomics 2021Quote: ... The digested sample was diluted with 400 µL T4 ligation buffer (NEB, M0202, 1% Triton X-100) and incubated at 37°C for 30 min ...
-
bioRxiv - Immunology 2020Quote: ... mRNA was isolated from purified 1 ng total RNA using oligo-dT beads (New England Biolabs, Inc). NEBNext Ultra™ RNA kit was used for full-length cDNA synthesis and library preparation ...
-
bioRxiv - Biochemistry 2021Quote: ... 1 µL of the purified product was ligated into a circular plasmid using KLD reaction mix (NEB) incubated for 10 min at room temperature.
-
bioRxiv - Biochemistry 2021Quote: ... with and without the addition of ACE2 (~1:1.25 S-protein trimer:ACE2 molar ratio) (New England Biolabs). Vitrified samples of S-protein constructs with and without ACE2 were prepared by first glow discharging Quantifoil R1.2/1.3 300 mesh holey carbon copper grids for 1 minute using a Pelco easiGlow glow discharge unit (Ted Pella ...
-
bioRxiv - Biochemistry 2021Quote: Radiolabeling of oligonucleotides was carried out for 1 h at 37 °C using T4 polynucleotide kinase (NEB), 0.25 μM oligonucleotide ...
-
bioRxiv - Microbiology 2021Quote: ... then heat inactivated at 65°C for 30 minutes and ligated using 1 µl Quick Ligase (NEB) at room temperature for 15 minutes ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1 μl of Protoscript II Reverse Transcriptase (200 U/μl, Catalog No. M0368, New England BioLabs Inc.), 2 μl of 0.1M dithiothreitol (DTT) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Free adaptor was then removed by addition of 1 μL 10 U/μL 5’-Deadenylase (NEB, M0331S). 1 μL 10 U/μL RecJ Exonuclease (Lucigen/Epicentre ...
-
bioRxiv - Microbiology 2021Quote: ... 1 µl from the supernatant was used for a 20 µl PCR reaction with Phusion polymerase (NEB), using primers oLGB21 (TGGGAGCAAGTTTTCTGAATTTGG ...
-
bioRxiv - Microbiology 2021Quote: ... and 10 μl of 2x Quick T4 ligase buffer and 1 μl Quick T4 DNA ligase (NEB) were added and incubated at room temperature overnight ...
-
bioRxiv - Plant Biology 2021Quote: The pGEX6P-1 vector (Cytiva, Tokyo, Japan) was digested with SalI-HF (New England Biolabs, Tokyo, Japan). Alleles of MvALS1/2/3/5 from the sensitive population (SMM13 ...
-
bioRxiv - Genomics 2020Quote: ... 50ng digested px330 was mixed with 1:250 diluted oligo duplex with 2X quick ligation buffer (NEB) and quick ligase (NEB ...
-
bioRxiv - Molecular Biology 2019Quote: RNA digestion of 20 OD260nm of cell extracts were performed by using 1 unit of Xrn1 (Biolabs) in NEB buffer 3 at 25°C during 30 min unless otherwise indicated ...
-
bioRxiv - Biophysics 2020Quote: 1 μg purified full length hGHR was incubated with 500 units of Endo-H (New Biolabs, USA) at 4 °C in 20 mM NaH2PO4/Na2HPO4 (pH 7.4) ...
-
bioRxiv - Genetics 2022Quote: ... The 5’ adaptor (rArCrArCrUrCrUrUrUrCrCrCrUrArCrArCrGrArCrGrCrUrCrUrUrCrCrGrArUrCrU, IDT) was then ligated to the product using T4 RNA ligase 1 (NEB) at 15 °C for 4 hours ...
-
bioRxiv - Microbiology 2022Quote: Ten μg of total DNA were digested with 1 μL of MmeI restriction enzyme (New England Biolabs) in 250 μL total volume with 10 μL of S-adenosyl methionine (SAM ...
-
bioRxiv - Microbiology 2022Quote: ... 10 min) and resuspended in 50 µl of 50 mM Tris-HCl containing 1 µg trypsin (NEB). After overnight incubation at 37 °C ...
-
bioRxiv - Microbiology 2022Quote: ... cDNA were synthesised from 1 µg RNA by reverse transcription using LunaScript RT SuperMix Kit (NEB; E3010). qRT-PCR was performed using Luna Universal qPCR Master Mix (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... Immunoprecipitation was performed overnight under rotation at 4 using 1/100 T7RNA antibody (Biolabs CB MAB-0296MC) and antiflag (Sigma F1804 and F3165) ...
-
bioRxiv - Microbiology 2022Quote: ... for 1 hr at 37°C and circularized with T4 DNA Ligase (New England Biolabs, MA, USA) overnight at room temperature using buffers and instructions provided by the manufacturer ...
-
bioRxiv - Neuroscience 2022Quote: ... with NEBNext® Multiplex Oligos for Illumina® (Dual Index Primers Set 1) (E7600S, New England BioLabs) based on manufacture instructions ...
-
bioRxiv - Synthetic Biology 2022Quote: ... for 1 h at 37°C into the PiggyBac recipient vector previously digested with BlpI (NEB #R0585S) and BstXI (NEB #R0113S ...
-
bioRxiv - Plant Biology 2022Quote: ... RNA was extracted using TRIzol reagent (MRC, USA) and ligated with T4 RNA ligase 1 (NEB, USA) at 37 °C for 1 h ...
-
bioRxiv - Microbiology 2022Quote: ... 75 μg of plasmid p28-1::flgBp-aacC1 [34] were digested with AgeI-HF (New England Biolabs), ethanol precipitated [68] ...
-
bioRxiv - Microbiology 2023Quote: ... 1 μl of RNase inhibitor and 3 μl of T4 RNA ligase 2 (truncated) (New England Biolabs) were added and mix well by pipetting ...
-
bioRxiv - Biochemistry 2023Quote: ... Bound protein was detected by western blot using mouse anti-MBP diluted 1:10,000 (New England Biolabs), fluorescent secondary antibodies (Li-Cor Biosciences) ...
-
bioRxiv - Genetics 2023Quote: ... Total RNA (1 µg) was reverse transcribed using ProtoScript II First Strand cDNA Synthesis Kit (NEB, E6560S) with primer UP0118 ...
-
bioRxiv - Developmental Biology 2023Quote: ... and NEBNext® Multiplex Oligos for Illumina® (New England Biolabs Index Primers Set 1; NEB, E7335S). Samples were pooled and submitted to MSKCC Integrated Genomics Operation core for quality control and sequencing on Illumina HiSeq 4000 platform.
-
bioRxiv - Developmental Biology 2023Quote: ... and NEBNext® Multiplex Oligos for Illumina® (New England Biolabs Index Primers Set 1; NEB, E7335S). Samples were pooled and submitted to MSKCC Integrated Genomics Operation core for quality control and sequencing on Illumina HiSeq 4000 platform.
-
bioRxiv - Biophysics 2023Quote: ... The clarified and filtered lysate was loaded on 1 mL of IgG Sepharose fast flow resin (NEB). The column was washed with lysis buffer and TEV cleavage buffer (lysis buffer with 75 mM NaCl ...
-
bioRxiv - Microbiology 2023Quote: ... pETduet-1::5′-flank_SpecPromoter_kanR_3′-flank and were subsequently digested from the plasmid using BamHI and NotI (NEB). The resultant insert (5′-flank_SpecPromoter_kanR_3′-flank ...
-
bioRxiv - Cell Biology 2023Quote: ... 1-cell stage embryos were injected with two guides for each gene with Cas9 protein (NEB, M0646T). Tyrosinase was an injection control to validate the efficacy of the Cas9 protein ...
-
bioRxiv - Biochemistry 2023Quote: ... 17 μl of the lysates was treated with 1 μl of Deglycosylation mix II (NEB, cat# P6044S) or distilled water ...
-
bioRxiv - Genetics 2022Quote: ... using the NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1) (New England Biolabs, Ipswich, MA). Paired-end 300 bp reads were generated on an Illumina MiSeq.
-
bioRxiv - Genetics 2023Quote: ... and NEBNext® Multiplex Oligos for Illumina® (New England Biolabs Index Primers Set 1; NEB, E7335S). Samples were pooled and submitted to MSKCC Integrated Genomics Operation core for quality control and sequencing on Illumina HiSeq 4000 platform.
-
bioRxiv - Genetics 2023Quote: ... and NEBNext® Multiplex Oligos for Illumina® (New England Biolabs Index Primers Set 1; NEB, E7335S). Samples were pooled and submitted to MSKCC Integrated Genomics Operation core for quality control and sequencing on Illumina HiSeq 4000 platform.
-
bioRxiv - Microbiology 2023Quote: ... cDNA was synthesized from 1 µg of total RNA using the LunaScript RT SuperMix kit (NEB, UK) in accordance with the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... A first round of PCR was performed using 1× Standard-Taq magnesium free reaction buffer pack (NEB) with 2 mM MgCl2 (NEB) ...
-
bioRxiv - Cancer Biology 2023Quote: ... then combined and treated with 1% SDS and 20 µg of proteinase K (New England Biolabs, #P8107S). The reaction was incubated for 1 h at 55°C ...
-
bioRxiv - Genomics 2023Quote: ... 1 μl of Hia5 MTase (200 U)19 and 1.5 μl 32 mM S-adenosylmethionine (NEB B9003S) (0.8 mM final concentration ...
-
bioRxiv - Cell Biology 2023Quote: ... Receptors were surface labeled by addition of SNAP-Surface Alexa Fluor 546 (1:1000, New England Biolabs) to DMEM F12 without serum and phenol red (21041-025 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... equimolar concentrations of the vectors were mixed with 1 µL I-SceI restriction enzyme (New England Biolabs) and 1 µL CutSmart buffer (10x ...
-
bioRxiv - Molecular Biology 2023Quote: ... The insert was ligated to the vector in a 3:1 ratio (insert:vector) using T4 ligase (NEB). This introduced C-terminal 6xHis tag to Syn0852 ...
-
bioRxiv - Biophysics 2024Quote: ... 10 µl of each sample was mixed with 4 µL native loading dye (1% Orange G (NEB) dissolved in 50% glycerol and 50% EMSA buffer ...
-
bioRxiv - Microbiology 2023Quote: ... 20 uL of sheared DNA was then digested with 1 U of DpnI in cutsmart buffer (NEB) for 3 hours at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... The samples were multiplexed with NEBNext Multiplex Oligos for Illumina (Index Primers Set 1 and 2) (NEB). Size selection steps were performed with Ampure XP beads (Beckman Coulter ...