Labshake search
Citations for New England Biolabs :
2101 - 2150 of 6463 citations for 7 6 7 dimethoxy 3 4 dihydroisoquinolin 1 yl 2 methyl 3 2 methylphenyl quinazolin 4 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... Either the wild-type or the mutant version of the PRNP 3’U R were inserted into the digested pmirGLO vector by performing a Gibson Assembly following manufacturer`s instructions (NEB). After transformation of the cloned vectors and purification of the DNA using EndoFree Plasmid Maxi Kit (Qiagen) ...
-
bioRxiv - Bioengineering 2021Quote: ... The flow cell was washed with water 3 times and then loaded with EcoRI-HF cocktail (1U EcoRI-HF (R3101, NEB) in 1X CutSmart NEB buffer ...
-
bioRxiv - Plant Biology 2021Quote: ... and 3 kb of upstream sequence containing the promoter was amplified from Arabidopsis genomic DNA using Phusion polymerase (New England Biolabs) using flanking primers and then the primers RSH1-F (TCCGTCTTGTCTGAATCAGCT ...
-
bioRxiv - Microbiology 2020Quote: ... The fluorescently labeled fragment was combined with the 5′ and 3′ unmodified RNAs by DNA-splinted RNA ligation using T4 DNA ligase (New England Biolabs) and purified by denaturing polyacrylamide gel electrophoresis ...
-
bioRxiv - Plant Biology 2021Quote: ... and the 3’ UTR sequence (310 bp downstream of the stop codon) were amplified by PCR using Phusion DNA polymerase (NEB) from genomic Col-0 DNA with IRT1p_-1024F 5’- CACCGACACATTAAACATTCATACCCGATT-3’ and IRT1_1546R 5’- CTTTAATTTACTTATCTTGAAAAAGCAGC-3’ ...
-
bioRxiv - Microbiology 2020Quote: ... designed to bind upstream of the polyA- tail at the 3’ end of the genome and dNTPs (10 mM, NEB), and incubated at 65 °C for 5 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNAs were isolated from Calu-3 infected cells 48h post infection using the Luna Cell Ready Lysis Module (New England Biolabs). Viral RNA were quantified by qRT-PCR in triplicate as described in [27] ...
-
bioRxiv - Microbiology 2021Quote: ... and reverse primer harboring ApaI site (5’- TATAGGGCCCTGCAATTTTTGGCTATG-3’) of the corresponding DNA sequence from pNL43 into the linearized pMiniT 2.0 vector (NEB, USA) as per manufacturer-recommended protocol ...
-
bioRxiv - Biochemistry 2021Quote: ... The reaction was stopped with the addition of 0.2% SDS and 3 units of Proteinase K (New England Biolabs, #P8107S), and incubated for 1 hr at 37°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... and then ligated to pre-annealed double-stranded adaptors that contain single dT overhangs and a unique molecular identifier (UMI) consisting of a randomized 8-base sequence containing a 3-base specific barcode by T4 DNA ligase (NEB) overnight at 15 °C ...
-
bioRxiv - Microbiology 2020Quote: ... Linkers (5’-ACTAGTTCCGAGCTCGAG-3’) with restriction sites for SpeI and XhoI were introduced by PCR based mutagenesis using the Q5 mutagensis kit (NEB) after codon 466 of nsP2 (2EGFP ...
-
bioRxiv - Genomics 2021Quote: ... a lentiCRISPRv2 derivative containing an optimized scaffold (5’-GTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTT-3’)40 were digested sequentially with NheI and BamHI (New England Biolabs). The vector and fragment were purified using the QIAquick Gel Extraction Kit (Qiagen ...
-
bioRxiv - Cell Biology 2021Quote: ... 50 ng of vector and 150 ng of each fragment were mixed with 3 μl of HiFi DNA Master Mix (NEB) and incubated at 50°C for 1 hour to form the new pCDH-TagBFP-T2A-myc-BirA*-Tensin3 construct ...
-
bioRxiv - Developmental Biology 2022Quote: ... fluorescent protein mCherry sequence and self-cleaving P2A peptide sequence (5’HA-H2B-mCherry-P2A-3’HA) in a pUC19 vector backbone using Gibson Assembly (New England Biolabs (NEB), E5510S) ...
-
bioRxiv - Genomics 2022Quote: ... and then ligated to the 3’ end of the cDNA by using thermostable 5’ App DNA/RNA Ligase (New England Biolabs) for 2 h at 65 °C ...
-
bioRxiv - Neuroscience 2022Quote: ... Mutation of the verified 7-mer binding site of the 3’-UTR of Zfp36l1 was performed using the Q5-site directed mutagenesis kit (New England BioLabs) using the following primers ...
-
HNRNPA2B1 controls an unfolded protein response-related prognostic gene signature in prostate cancerbioRxiv - Cancer Biology 2022Quote: ... was combined with forward and reverse primers (Supplementary Table 3) and the Luna Universal qPCR Master Mix master mix (M3003, NEB) containing SYBR green and ROX passive dye to a final 10ul reaction volume ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2019 [36] with the modification that 3 µg of gDNA per technical replicate were digested using Nucleoside Digestion Mix (NEB M0649S ...
-
bioRxiv - Physiology 2022Quote: ... while an additional step which added 3’ A-overhangs to the slc15a2a purified PCR product was performed using Taq DNA polymerase (New England Biolabs) before cloning into pCR4-TOPO vector (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5’ and 3’ flanking sequences containing recognition sites for the Type II restriction enzyme BsaI-HF®v2 (NEB, R3733) were added to each IUPAC DNA block ...
-
bioRxiv - Genetics 2022Quote: ... then the single nucleotide (A) was added to the end of the digestive fragment by Klenow fragment (3’-5’ exo-) (NEB) with dATP at 37°C ...
-
bioRxiv - Biochemistry 2020Quote: ... the human Rab1b 3-174aa (referred to as Rab1b)-encoding DNA was cloned into a modified pMAL vector (New England Biolabs), resulting in a construct with a N-terminal hexahistidine (6xHis ...
-
bioRxiv - Plant Biology 2021Quote: ... the RNA was subsequently ligated to an RNA adapter with a 3’ phosphate group by RtcB ligase (#M0458S, New England Biolabs). The ligated RNA was converted to cDNA with RevertAid first strand cDNA synthesis kit (#K1612 ...
-
bioRxiv - Microbiology 2021Quote: ... The protruding 3’ ‘A’ base was then used for ligation with the NEBNext Multiplex Oligos for Illumina (New England Biolabs) which have a single 3’ overhanging ‘T’ base and a hairpin structure ...
-
bioRxiv - Microbiology 2021Quote: ... From AF293 genomic DNA we amplified a ~4 kb fragment that included ~1kb 5’ and ~200 bp 3’ of sskA and introduced PacI and NotI (New England Biolabs) restriction sites at the 5’ and 3’ ends ...
-
bioRxiv - Neuroscience 2020Quote: ... according to the manufacturer’s recommendations and subjected to ligation (2h at RT) with a pre-adenylated 3’ linker (2µM final) and a truncated T4 ligase (NEB M0373L). Ligated RPFs of 50 – 70 nucleotides (nt ...
-
bioRxiv - Plant Biology 2021Quote: ... Flanking sequences 5’ and 3’ of the coding regions were amplified with appropriate primer pairs (Table S2) using Phusion DNA polymerase (New England Biolabs) and cloned into pDONR 221 P1-P4 and pDONR 221 P3-P2 ...
-
bioRxiv - Microbiology 2020Quote: ... A-tails were added to the 3′ ends of the DNA by incubating the beads with Klenow fragment (exo-) (NEB) in a 100 μL reaction ...
-
bioRxiv - Cell Biology 2020Quote: ... Four hundred ng of total RNA extracted from pools of 250 mouse oocytes was ligated to 400 ng of P1 anchor primer (5’-P-GGT CAC CTT GAT CTG AAG C-NH2-3’) in a 10-µl reaction using T4 RNA ligase (New England Biolabs) for 30 min at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... and poly(G) tails were added at the 3’ end of the purified ssDNA by terminal transferase (New England Biolabs). The double-stranded DNA was then synthesized and amplified by PCR from the poly(AG)-tailed ssDNA using the primers BLV-F2 and NV-oligo-dT-ADP1 and Q5 Hot Start High-Fidelity DNA Polymerase (New England Biolabs) ...
-
bioRxiv - Genomics 2022Quote: ... 3’UTR fragment was assembled into a plasmid (VRQRABE-mRNA plasmid) using NEBuilder HiFi DNA Assembly Master Mix (NEB, E2621S) according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... 40 μL of each digest product were then ran on a 3% agarose gel and the appropriate band was gel extracted using a kit (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... 40 μL of digest product was then ran on a 3% agarose gel and the appropriate band was gel extracted using a kit (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... single-stranded adaptors (5’-Phos – ATCCACAACAACTCTCCTCCTC – 3’) were linked to the AdSDV genome segments using T4 RNA ligase I (New England Biolabs). Using the reverse adaptor primer paired with another primer ...
-
bioRxiv - Cancer Biology 2019Quote: ... The lyophilized peptides were resuspended in 200 µl of 50 mM ammonium bicarbonate to which 3 µl of PNGaseF (New England Biolabs) were added for a 4h incubation at 37C ...
-
bioRxiv - Cell Biology 2019Quote: ... we introduced flanking FRT sites 104bp upstream of the transcription start site and 99bp downstream of the end of the 3’UTR using a Q5 Site-Directed Mutagenesis kit (New England Biolabs) and the following primers:
-
bioRxiv - Cell Biology 2019Quote: ... the M2×24 array was cloned into the pUBC-HaloTag-bActinCDS-bActinUTR-MS2V5 using 20 bp of 5’ and 3’ homology to replace the MS2 cassette using the Hifi builder enzyme mix (NEB). This was later followed by further Gibson assembly of the Halo-bActinCDS-bActinUTR-M2×24 insert into the pLenti-puro backbone using NEB Hifi builder ...
-
bioRxiv - Molecular Biology 2019Quote: ... The resulting PCR product was ligated to the EcoRI-SbfI digested pLs-mP backbone in 3 separate Gibson assembly reactions (HiFi DNA Assembly, NEB). 2 µL of each Gibson assembly reaction were transformed into Stbl4 electrocompetent E ...
-
bioRxiv - Cell Biology 2019Quote: ... To visualize SNAP-tagged dCENP-A proteins cells were labelled with 3 µM SNAP-Cell TMR Star (New England Biolabs) for 30 min ...
-
bioRxiv - Cell Biology 2020Quote: ... The AP-3 sorting mutant was regenerated in MigR1-PI4KIIα-GFP using the Q5 site-directed mutagenesis kit (New England Biolabs) following manufacturer’s instructions ...
-
Suppressing STAT3 activity protects the endothelial barrier from VEGF-mediated vascular permeabilitybioRxiv - Molecular Biology 2020Quote: ... to a final concentration of 0.1µg/ml was incubated with 3 µg purified STAT3 proteins as well as 5 µl ATP (New England Biolabs; N0440S) for 30 minutes at 30°C ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The targeted genomic locus was then PCR amplified with primers flanking the expected cutting site (Supplementary Table 3) using Q5 Hot Start High-Fidelity Polymerase (NEB). 5 μl of the resulting amplicon were diluted 1:4 in 1x buffer 2 (NEB) ...
-
bioRxiv - Microbiology 2019Quote: ... and YO-3009 (5’-ggg ccc acc ggt CGC CAG AAT GCG TTC GCA CAG CCG CCA GC-3’) and Q5 polymerase (NEB), then cloned into the SacI and AgeI sites of pSL1180/S17DN ...
-
bioRxiv - Microbiology 2020Quote: ... before resuspending the beads in 25 μl RNA ligation mix (9 μl H2O, 3 μl 10x T4 RNA ligase buffer (NEB), 0.3 μl 0.1M ATP ...
-
bioRxiv - Microbiology 2021Quote: ... was amplified by PCR using primers motAB-Fwd-KpnI and motAB-rev-SacI (Table S2) and ligated into plasmid pBBR1MCS-3 after restriction with enzymes SacI and KpnI (NEB). Ligation products were transformed into E ...
-
bioRxiv - Genetics 2019Quote: ... The repair templates were made by annealing oligos in Table S3 and extending the 3’ ends using Phusion Polymerase (New England Biolabs). The pol30-6 (D41A ...
-
bioRxiv - Genomics 2019Quote: ... samples were digested with 10 U pshAI in 1x CutSmart buffer at 37°C for 3 or more hours (NEB).
-
bioRxiv - Systems Biology 2019Quote: ... and C-terminal AD was instead PCR amplified from pGADCg using forward primer AP36 and reverse primer AP38 (5’ GCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGGCAGcatctattgaagtaat aataggcgcatg 3’) and cloned into NotI- and XmaI-digested (NEB) pDest-AD-QZ213 via homologous recombination in yeast ...
-
bioRxiv - Genomics 2021Quote: ... a 5’ adenylated DNA oligonucleotide containing the complement of an Illumina Read 1 sequencing primer-binding site was then ligated to the 3’ cDNA end with Thermostable 5’ AppDNA / RNA Ligase (New England Biolabs). Properly ligated cDNAs were amplified by PCR (12 cycles ...
-
bioRxiv - Genetics 2021Quote: ... two complementary oligos containing the guide sequence and a BbsI recognition site (Oligo F: 5’CACCGNNNNNNNNNN….3’ and Oligo R: 5’AAACNNNNNNNNNN…..C3’) were annealed and cloned into the BbsI (NEB) digested target plasmid.