Labshake search
Citations for New England Biolabs :
2051 - 2100 of 3325 citations for Galectin 1 Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2019Quote: ... After washing the pellet two times with 1ml of 1 × NEB buffer 2.1 (New England BioLabs (NEB), USA) ...
-
bioRxiv - Developmental Biology 2019Quote: ... E7.5) into 96 well PCR plates containing 2.5μl of methylase reaction buffer (1× M.CviPI Reaction buffer (NEB), 2U M.CviPI (NEB) ...
-
bioRxiv - Genomics 2021Quote: The GCG1/SUT098 FPR plasmid was digested with AvrII and BglII (1 U per µg plasmid, NEB) restriction enzymes to excise the NatMX6 cassette ...
-
bioRxiv - Genomics 2021Quote: ... and resuspended in 1 x DPBS with 0.4 mg/ml bovine serum albumin (# 74719, New England Biolabs) at approximately 1000 cells/µl ...
-
bioRxiv - Genomics 2021Quote: ... 8.5 µL of this phosphorylated product was combined with 1 µL of 10X T4 ligase buffer (NEB) and 0.5 µL of T4 DNA ligase (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... The primary antibodies used in this study were rabbit anti-GLuc 1:2,000 (E8023S, New England Biolabs), rabbit anti-epidermal growth factor receptor (EGFR) ...
-
bioRxiv - Genomics 2021Quote: ... The digested sample was diluted with 400 µL T4 ligation buffer (NEB, M0202, 1% Triton X-100) and incubated at 37°C for 30 min ...
-
bioRxiv - Immunology 2020Quote: ... mRNA was isolated from purified 1 ng total RNA using oligo-dT beads (New England Biolabs, Inc). NEBNext Ultra™ RNA kit was used for full-length cDNA synthesis and library preparation ...
-
bioRxiv - Biochemistry 2021Quote: ... 1 µL of the purified product was ligated into a circular plasmid using KLD reaction mix (NEB) incubated for 10 min at room temperature.
-
bioRxiv - Biochemistry 2021Quote: ... with and without the addition of ACE2 (~1:1.25 S-protein trimer:ACE2 molar ratio) (New England Biolabs). Vitrified samples of S-protein constructs with and without ACE2 were prepared by first glow discharging Quantifoil R1.2/1.3 300 mesh holey carbon copper grids for 1 minute using a Pelco easiGlow glow discharge unit (Ted Pella ...
-
bioRxiv - Biochemistry 2021Quote: Radiolabeling of oligonucleotides was carried out for 1 h at 37 °C using T4 polynucleotide kinase (NEB), 0.25 μM oligonucleotide ...
-
bioRxiv - Microbiology 2021Quote: ... then heat inactivated at 65°C for 30 minutes and ligated using 1 µl Quick Ligase (NEB) at room temperature for 15 minutes ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1 μl of Protoscript II Reverse Transcriptase (200 U/μl, Catalog No. M0368, New England BioLabs Inc.), 2 μl of 0.1M dithiothreitol (DTT) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Free adaptor was then removed by addition of 1 μL 10 U/μL 5’-Deadenylase (NEB, M0331S). 1 μL 10 U/μL RecJ Exonuclease (Lucigen/Epicentre ...
-
bioRxiv - Microbiology 2021Quote: ... 1 µl from the supernatant was used for a 20 µl PCR reaction with Phusion polymerase (NEB), using primers oLGB21 (TGGGAGCAAGTTTTCTGAATTTGG ...
-
bioRxiv - Microbiology 2021Quote: ... and 10 μl of 2x Quick T4 ligase buffer and 1 μl Quick T4 DNA ligase (NEB) were added and incubated at room temperature overnight ...
-
bioRxiv - Plant Biology 2021Quote: The pGEX6P-1 vector (Cytiva, Tokyo, Japan) was digested with SalI-HF (New England Biolabs, Tokyo, Japan). Alleles of MvALS1/2/3/5 from the sensitive population (SMM13 ...
-
bioRxiv - Genomics 2020Quote: ... 50ng digested px330 was mixed with 1:250 diluted oligo duplex with 2X quick ligation buffer (NEB) and quick ligase (NEB ...
-
bioRxiv - Molecular Biology 2019Quote: RNA digestion of 20 OD260nm of cell extracts were performed by using 1 unit of Xrn1 (Biolabs) in NEB buffer 3 at 25°C during 30 min unless otherwise indicated ...
-
bioRxiv - Biophysics 2020Quote: 1 μg purified full length hGHR was incubated with 500 units of Endo-H (New Biolabs, USA) at 4 °C in 20 mM NaH2PO4/Na2HPO4 (pH 7.4) ...
-
bioRxiv - Genetics 2022Quote: ... The 5’ adaptor (rArCrArCrUrCrUrUrUrCrCrCrUrArCrArCrGrArCrGrCrUrCrUrUrCrCrGrArUrCrU, IDT) was then ligated to the product using T4 RNA ligase 1 (NEB) at 15 °C for 4 hours ...
-
bioRxiv - Microbiology 2022Quote: Ten μg of total DNA were digested with 1 μL of MmeI restriction enzyme (New England Biolabs) in 250 μL total volume with 10 μL of S-adenosyl methionine (SAM ...
-
bioRxiv - Microbiology 2022Quote: ... 10 min) and resuspended in 50 µl of 50 mM Tris-HCl containing 1 µg trypsin (NEB). After overnight incubation at 37 °C ...
-
bioRxiv - Microbiology 2022Quote: ... cDNA were synthesised from 1 µg RNA by reverse transcription using LunaScript RT SuperMix Kit (NEB; E3010). qRT-PCR was performed using Luna Universal qPCR Master Mix (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... Immunoprecipitation was performed overnight under rotation at 4 using 1/100 T7RNA antibody (Biolabs CB MAB-0296MC) and antiflag (Sigma F1804 and F3165) ...
-
bioRxiv - Microbiology 2022Quote: ... for 1 hr at 37°C and circularized with T4 DNA Ligase (New England Biolabs, MA, USA) overnight at room temperature using buffers and instructions provided by the manufacturer ...
-
bioRxiv - Neuroscience 2022Quote: ... with NEBNext® Multiplex Oligos for Illumina® (Dual Index Primers Set 1) (E7600S, New England BioLabs) based on manufacture instructions ...
-
bioRxiv - Synthetic Biology 2022Quote: ... for 1 h at 37°C into the PiggyBac recipient vector previously digested with BlpI (NEB #R0585S) and BstXI (NEB #R0113S ...
-
bioRxiv - Plant Biology 2022Quote: ... RNA was extracted using TRIzol reagent (MRC, USA) and ligated with T4 RNA ligase 1 (NEB, USA) at 37 °C for 1 h ...
-
bioRxiv - Microbiology 2022Quote: ... 75 μg of plasmid p28-1::flgBp-aacC1 [34] were digested with AgeI-HF (New England Biolabs), ethanol precipitated [68] ...
-
bioRxiv - Microbiology 2024Quote: ... 1 µg of DNA was mixed with 7 µl NEBNext Ultra II end prep reaction buffer (NEB) and 3 µl Ultra II end prep enzyme mix (NEB) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 uL RNase A and 1 uL ProtK all from the Monarch gDNA extraction kit (NEB, T3010). gDNA was extracted following the extraction kit’s protocol with the exception that 600 uL of gDNA binding buffer were added to 400 uL quenched reaction and added to the extraction column on two spins of 2 minutes at 1000g ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... with NEBNext Multiplex Oligos for Illumina (Dual Index Primers Sets 1 and 2) (NEB #E7600S and #E7780S), with two-sided size selection around a mode of 480 base pairs ...
-
bioRxiv - Molecular Biology 2024Quote: ... The resulting eluant was further treated with 1% SDS and 8 U/mL proteinase K (NEB, P8107S) at 42°C for 20 minutes then phenol chloroform extracted and ethanol precipitated.
-
bioRxiv - Cell Biology 2024Quote: ... cells were treated for 90 min with a 1:150 dilution of RNase III (New England Biolabs) in low-salt buffer (50 mM Tris-HCl pH 7.6 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 1 μg RCA product was restricted by employing 10 U nicking endonuclease Nb.BbvCI (New England Biolabs, R0631L) in a 50 μL reaction volume with 1x rCutsmart buffer for 1 h at 37 °C ...
-
bioRxiv - Microbiology 2023Quote: ... 1 μl of RNase inhibitor and 3 μl of T4 RNA ligase 2 (truncated) (New England Biolabs) were added and mix well by pipetting ...
-
bioRxiv - Biochemistry 2023Quote: ... Bound protein was detected by western blot using mouse anti-MBP diluted 1:10,000 (New England Biolabs), fluorescent secondary antibodies (Li-Cor Biosciences) ...
-
bioRxiv - Genetics 2023Quote: ... Total RNA (1 µg) was reverse transcribed using ProtoScript II First Strand cDNA Synthesis Kit (NEB, E6560S) with primer UP0118 ...
-
bioRxiv - Developmental Biology 2023Quote: ... and NEBNext® Multiplex Oligos for Illumina® (New England Biolabs Index Primers Set 1; NEB, E7335S). Samples were pooled and submitted to MSKCC Integrated Genomics Operation core for quality control and sequencing on Illumina HiSeq 4000 platform.
-
bioRxiv - Developmental Biology 2023Quote: ... and NEBNext® Multiplex Oligos for Illumina® (New England Biolabs Index Primers Set 1; NEB, E7335S). Samples were pooled and submitted to MSKCC Integrated Genomics Operation core for quality control and sequencing on Illumina HiSeq 4000 platform.
-
bioRxiv - Biophysics 2023Quote: ... The clarified and filtered lysate was loaded on 1 mL of IgG Sepharose fast flow resin (NEB). The column was washed with lysis buffer and TEV cleavage buffer (lysis buffer with 75 mM NaCl ...
-
bioRxiv - Microbiology 2023Quote: ... pETduet-1::5′-flank_SpecPromoter_kanR_3′-flank and were subsequently digested from the plasmid using BamHI and NotI (NEB). The resultant insert (5′-flank_SpecPromoter_kanR_3′-flank ...
-
bioRxiv - Cell Biology 2023Quote: ... 1-cell stage embryos were injected with two guides for each gene with Cas9 protein (NEB, M0646T). Tyrosinase was an injection control to validate the efficacy of the Cas9 protein ...
-
bioRxiv - Biochemistry 2023Quote: ... 17 μl of the lysates was treated with 1 μl of Deglycosylation mix II (NEB, cat# P6044S) or distilled water ...
-
bioRxiv - Genetics 2022Quote: ... using the NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1) (New England Biolabs, Ipswich, MA). Paired-end 300 bp reads were generated on an Illumina MiSeq.
-
bioRxiv - Genetics 2023Quote: ... and NEBNext® Multiplex Oligos for Illumina® (New England Biolabs Index Primers Set 1; NEB, E7335S). Samples were pooled and submitted to MSKCC Integrated Genomics Operation core for quality control and sequencing on Illumina HiSeq 4000 platform.
-
bioRxiv - Genetics 2023Quote: ... and NEBNext® Multiplex Oligos for Illumina® (New England Biolabs Index Primers Set 1; NEB, E7335S). Samples were pooled and submitted to MSKCC Integrated Genomics Operation core for quality control and sequencing on Illumina HiSeq 4000 platform.
-
bioRxiv - Microbiology 2023Quote: ... cDNA was synthesized from 1 µg of total RNA using the LunaScript RT SuperMix kit (NEB, UK) in accordance with the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... A first round of PCR was performed using 1× Standard-Taq magnesium free reaction buffer pack (NEB) with 2 mM MgCl2 (NEB) ...