Labshake search
Citations for New England Biolabs :
1951 - 2000 of 4801 citations for Mouse Anti Human Immunodeficiency Virus HIV 1 Integrase 2 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2024Quote: ... cDNA (2 μl) was used as template in 50 μl PCR reaction with Phusion Hot start flex (New England Biolabs). Reaction conditions ...
-
bioRxiv - Plant Biology 2024Quote: ... with 2 µg of the freshly synthetized SgRNA1 obtained with the HiScribe™ T7 High Yield RNA Synthesis Kit (NEB). DNA repair templates containing the fenhexamid resistance cassette surrounded by 60 bp of the target gene for HR were obtained by PCR ...
-
bioRxiv - Plant Biology 2024Quote: ... Libraries were selected for cDNA target fragments of 300 bp on 2% Low Range Ultra Agarose followed by PCR amplified using Phusion DNA polymerase (NEB) for 15 PCR cycles ...
-
bioRxiv - Immunology 2023Quote: ... Completed libraries were then sequenced to an average depth of approximately 20M reads per sample on a partial lane of the NovaSeq6000 S4 XP flow cell using 2×150 paired-end reads with 10-base dual indexes (CAS: E6440S, NEB). After demultiplexing these samples ...
-
bioRxiv - Molecular Biology 2023Quote: ... Monophosphorylated RNAs were ligated to 3′ adapters ( rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/, IDT) using T4 RNA ligase 2 in 25% PEG 8000 (NEB) at 15°C overnight ...
-
bioRxiv - Pathology 2023Quote: Total RNA extracted from hearts of Ctrl and Eprs1cKO-homoat 2 weeks post tamoxifen injection were treated with DNase I (NEB) to remove potential genomic DNA in the RNA samples ...
-
bioRxiv - Molecular Biology 2024Quote: 100 ng polyA+ RNA was annealed with 2 μl of 10 μM Oligo(dT)30VN primer (5’-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN-3’) and 2 μl of 10 mM dNTP mix (NEB) in 12 μl solution ...
-
bioRxiv - Molecular Biology 2024Quote: ... Nicks were sealed by adding 10 μL 10x T4 DNA ligase buffer and 2 μL T4 DNA ligase (New England Biolabs) and incubating overnight at 16°C ...
-
bioRxiv - Microbiology 2024Quote: ... The SV40 NLS was added to the C-terminus of CypA via annealing partially complimentary primers encoding the SV40 NLS (Table S1) at 20 μM with NEB buffer 2 (New England Biolabs) at 95° C for 4 min and 70° C for 10 min ...
-
bioRxiv - Microbiology 2024Quote: Quantification of SARS-CoV-2 E gene subgenomic mRNA (sgmRNA) was conducted using Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) on a Step One Plus Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Microbiology 2024Quote: ... Four PCR fragments of around 2,700 nucleotides long were generated from cDNA using primer pairs (Suppl. Table S2) with NEB Q5 Hot-Start high-fidelity 2× Master Mix (New England Biolabs). Fragments were gel-purified with MinElute gel extraction Kit (Qiagen ...
-
bioRxiv - Microbiology 2024Quote: ... Radioactively labelled tRNAs carrying a 2′,3′ cyclic phosphate at the 3′ end was dephosphorylated using T4 polynucleotide kinase (NEB) in 100 mM Tris-HCl pH 6.5 ...
-
bioRxiv - Biochemistry 2024Quote: Fab Fragments were generated by taking .5 mg of IgG and digesting with 2 µL of Lys C (NEB#P8109S) at 37℃ ...
-
bioRxiv - Biochemistry 2024Quote: ... After 30 mins the samples were placed on ice and 2 μl loading dye (Purple gel loading dye, no SDS, B7025 New England Biolabs) was added prior to loading 12 μl onto a 1.5% 15 x 15 cm 100 ml 0.5X TB agarose gel ...
-
bioRxiv - Biochemistry 2023Quote: ... Libraries were size selected for cDNA target fragments of 300 bp on 2% Low Range Ultra Agarose followed by PCR amplified using Phusion DNA polymerase (NEB) for 15 PCR cycles ...
-
bioRxiv - Cell Biology 2024Quote: ... each lysed by incubation in 1000 μL RIPA buffer + 2 mM PMSF + 60 μL PIC + 112.5 Kunitz Unit/mL DNase I (RNase-free, NEB M0303) + 2.5 mM MgCl2 (Sigma 5985-OP ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2) library for miRNAs detection utilizing NEBNext® Small RNA Library Prep Set for Illumina (New England Biolabs (UK) Ltd ...
-
bioRxiv - Plant Biology 2020Quote: ... pan-anti-Khib (PTM Biolabs, China, Catalog No. PTM-801), and pan-anti-acetyllysine (pan-anti-Kac ...
-
bioRxiv - Immunology 2021Quote: ... were coated with 50 μL anti-MBP (New England Biolabs) at 3 ug/mL in Tris Buffered Saline (TBS ...
-
bioRxiv - Microbiology 2021Quote: ... or 5 µl anti-H3K18cr antibody (PTM-517, PTM Biolabs) together with protein A agarose (Roche ...
-
bioRxiv - Biochemistry 2022Quote: ... pH 7.4) and probed with anti-succinyl lysine (PTM Biolabs), then probed with secondary antibody in milk in Tris-buffered saline ...
-
bioRxiv - Cancer Biology 2022Quote: ... antibody and anti-Gluc antibody (New England Biolabs, ref. E8023).
-
bioRxiv - Developmental Biology 2023Quote: ... a MBP antibody (Anti-MBP Monoclonal Antibody, HRP conjugated, NEB), a GST antibody (GST Tag Monoclonal Antibody ...
-
bioRxiv - Biophysics 2020Quote: ... 1 μL T4 polynucleotide kinase and 1 μL DpnI (New England Biolabs, Cats. #M0201S and R0176S) and incubated at 37°C for 1 hour ...
-
bioRxiv - Genomics 2022Quote: ... 1 μg of PCR product containing barcoded oligos were inserted into 1 μg SfiI (NEB, R0123) digested empty vector A or P by gibson assembly NEBuilder HiFi DNA Assembly Master Mix (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μL of 10 mM ATP and 1 μL of T4 DNA ligase (New England Biolabs) were added and the ligation reaction was incubated for 5 cycles at 20°C for one hour followed by 37°C for 30 min ...
-
bioRxiv - Cell Biology 2021Quote: ... and 1 mM MnCl2 only or together with 1 μl Lambda Protein Phosphatase (New England Biolabs). After incubation at 30°C for 30 min ...
-
bioRxiv - Microbiology 2022Quote: ... Filtered (0.45 μm) supernatants were treated with 1 U/ml DNAse I (NEB; 1 h, RT) and purified through a 20% sucrose cushion (2 h ...
-
bioRxiv - Bioengineering 2022Quote: ... Then CaCl2 was added to 2mM and 1 µL (about 1 µg) of Factor Xa (NEB) was added per 50 µg of protein and the samples were left at RT for 20-24h ...
-
A rapid, highly sensitive and open-access SARS-CoV-2 detection assay for laboratory and home testingbioRxiv - Molecular Biology 2021Quote: ... 1 μM Ultramer was annealed with 1 μM T7-3G oligonucleotide in 1x Taq Buffer (NEB) in a final volume of 10 μl by heating the reaction up to 95°C for 5 minutes ...
-
bioRxiv - Pathology 2022Quote: ... and 1 mM DTT containing [3H] SAM (25:1 molar ratio of SAM(NEB, Cat#B9003S) to [methyl-3H]-SAM (PerkinElmer ...
-
bioRxiv - Synthetic Biology 2019Quote: ... and inserts and plasmid were ligated at a 1:1 molar ratio with Quick Ligase (NEB) for 20 min at room temperature ...
-
bioRxiv - Zoology 2020Quote: ... Briefly: agarose plugs were pre-incubated for 1 hour with 1× Cutsmart buffer (New England Biolabs), followed by overnight incubation with 20U restriction enzymes HinfI and 20U RsaI (New England Biolabs ...
-
bioRxiv - Molecular Biology 2020Quote: ... The plug was then equilibrated twice in 1 ml of 1× NEBuffer 3.1 (New England Biolabs) by rotating the tube for 30 min at room temperature ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Reagents added were 1 μl of 1 mg/ml BSA (diluted from 20 mg/ml - NEB), 1 μl T4 DNA ligase buffer (NEB or Thermo Fisher Scientific) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Then 0.3 μL of 1 mg mL−1 trypsin (trypsin-ultra, MS-grade, New England Biolabs) was added and samples were incubated at 37 °C overnight ...
-
bioRxiv - Microbiology 2023Quote: ... Filtered (0.45 µm) supernatants were treated with 1 U/ml DNAse I (NEB; 1 h, RT) and purified through a 20% sucrose cushion (2 h ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 μL T4 DNA ligase (400 U/μl) and 1 μl BsaI-HFv2 (M0202S, R3733S, NEB) and water to 15 μl ...
-
bioRxiv - Neuroscience 2023Quote: ... The oligonucleotides were mixed at a 1:1 ratio and phosphorylated with T4 PNK (NEB, M0201) and annealed in T4 ligase buffer (NEB ...
-
Essential roles of the ANKRD31-REC114 interaction in meiotic recombination and mouse spermatogenesisbioRxiv - Genetics 2023Quote: ... Plugs were washed in 500 µl of 1× T4 polymerase buffer (1× T4 ligase buffer (NEB) supplemented with 100 μg/ml BSA and 100 μM dNTPs (Roche) ...
-
bioRxiv - Microbiology 2024Quote: ... and used in a 1:1 molar ratio Golden Gate assembly reaction with BsaI-HF2 (NEB) and T4 ligase (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... sgRNA target site mutation in mouse Thap1 cDNA was generated by Q5 Site-Directed Mutagenesis Kit (NEB, see Table S3 for primers). WT or Thap1-/-Brca1Δ11 MEFs (1 × 106 ...
-
bioRxiv - Cell Biology 2023Quote: ... Equal amounts of genomic DNA were digested and loaded into each lane. Mouse (M. musculus and M. spretus) genomic DNA was digested with methylation-sensitive (HpyCH4IV, NEB cat. R0619L) or methylation-insensitive (ApoI ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 1 µL T4 PNK (NEB) followed by incubation for 60 min at 37 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 μl (10U) T7 endonuclease (NEB) were added to the hybridized PCR products and incubated for 15min at 37°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1 µl rSAP (NEB, Cat M0371) was then added to dephosphorylate 3’ end of DNA at 37℃ for 1hr ...
-
bioRxiv - Microbiology 2022Quote: ... and 1 µl 5’deadenylase (NEB) at 30°C for 30 min and removed by RNA Clean & Concentrator (Zymo Research) ...
-
bioRxiv - Microbiology 2022Quote: ... 1 µl of rSAP enzyme (NEB) and 1 µl of PNK enzyme (NEB) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 x protease inhibitor cocktail (NEB), 2 mM N-ethylmaleimide (NEM) ...
-
bioRxiv - Molecular Biology 2021Quote: ... in 1X NEBuffer 1 (NEB #B7001) for 15 min at 37°C while shaking at 1000 rpm for an interval of 15 sec every 3 min ...