Labshake search
Citations for New England Biolabs :
1951 - 2000 of 2132 citations for 7 Chloro quinazoline 2 4 diamine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... 150 ng of double stranded gBlock® template or 2 µg of plasmid template was transcribed using the HiScribe T7 High Yield RNA Synthesis Kit (New England BioLabs®). At the end of the reaction ...
-
bioRxiv - Genomics 2019Quote: ... three sets of ligation reactions were set up by incubating 600 ng of purified digested DNA with 2 µl of high-concentration T4 DNA ligase (NEB, M0202T) overnight at 4C in a volume of 400 µl ...
-
bioRxiv - Genomics 2019Quote: ... were PCR-amplified (2 PCR reactions, 12 cycles) using Illumina adapter-specific primers and NEBNext® Ultra II Q5 Master Mix (NEB). After library profile analysis by Agilent 2100 Bioanalyser (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2020Quote: ... where 200pmol 5’-adenylated,3-dideoxyC DNA adapters (Table 1) were ligated with 400U truncated T4 RNA ligase 2 (NEB M0242) in 1X ATP-free T4 RNA ligase buffer [50mM Tris pH 7.5 ...
-
bioRxiv - Biochemistry 2020Quote: cDNA was reverse-transcribed from donor 1 and donor 2 RNA samples using the ProtoScript II first strand cDNA synthesis kit (NEB #E6560) with oligo dT priming ...
-
bioRxiv - Genetics 2020Quote: Libraries were prepared from 2 ng of DNA using the NEBNext Ultra II FS DNA library prep kit (New England Biolabs, USA) following the manufacturer’s instructions ...
-
bioRxiv - Pathology 2019Quote: ... protocol using the PCR Barcoding Expansion 1-12 (EXP-PBC001) kit (ONT) and LongAmp Taq 2× Master Mix (New England Biolabs, MA) with the following thermocycling conditions ...
-
bioRxiv - Plant Biology 2021Quote: ... 2.5 µl 25 µM Custom Nextera PCR Primer 2 and 25 µl NEB Next High Fidelity 2x PCR Master Mix (NEB, #M0541) with 1 cycle of (72°C for 5 min ...
-
bioRxiv - Systems Biology 2019Quote: ... the Nickel-NTA beads were incubated in 80 μl 3’-linker ligation mix with (1 X PNK buffer, 1 µM 3’-adapter, 10% PEG8000, 30U Truncated T4 RNA ligase 2 K227Q (NEB, M0351L), 60U RNasin) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.2 μg protein were denatured as above and adjusted to a final concentration of 1x Glycobuffer 2 containing 125U PNGase F per μg (NEB, P0704S) in 50 μl ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 0.5-1.0 μg of genomic DNA for each sample was heated at 65°C for 2-3 hours prior to digestion with PstI (New England Biolabs, UK). This enzyme has a 6 bp recognition site and leaves a 4 bp overhang ...
-
bioRxiv - Microbiology 2020Quote: ... was linerized by inverse PCR with primers 13 and 14 and the duplex oligo was ligated to the linearized plasmid in a 2:1 insert:vector molar ratio using NEBuilder Hifi Assembly Master Mix (New England Biolabs, Ipswich, Massachusetts) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... A preadenylated DNA adaptor sequence was ligated to the 3’-hydroxyl ends of the RNA fragments using T4 RNA Ligase (T4 RNA Ligase 2, truncated K227Q, NEB #M0351S). The ligated RNA product was reverse transcribed using Superscript III and a barcoded primer with sequence complementarity to the adaptor ...
-
bioRxiv - Immunology 2019Quote: ... and libraries were prepared from 2 ng of total RNA using the NEBNext low input kit (New England Biolabs, Hitchen, U.K.). Libraries were assessed for correct size distribution on the Agilent 2200 TapeStation and quantified by Qubit DNA High Sensitivity assay (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... The PCR product was denatured and annealed in an 18 μl reaction (15 μl PCR product, 2 μl NEB Buffer2 (10X), 1 μl nuclease-free H2O ...
-
bioRxiv - Microbiology 2021Quote: Cloning of the plf gene clusters and plfG and papG genes encoding the different classes of adhesins were obtained by PCR amplification using specific primers (Table 2) and Q5 High Fidelity-DNA polymerase (New England Biolabs [NEB]). The A-Tailing Kit (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 µl Forward Stagger Mix (10 µM) and 2 µl Reverse Index Primer (10 µM) specific to each vector backbone and Nuclease-free water (NEB,USA) up to 50 µl ...
-
bioRxiv - Molecular Biology 2021Quote: ... Eluted RNA was treated with T4 PNK and preadenylated linker was ligated to the 3’ end using T4 RNA Ligase 2 truncated KQ (NEB, M0373L). Linker-ligated footprints were reverse transcribed using Superscript III (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... 1 mL of the IEC fraction was concentrated for 4 h in vacuum to which 20 μL of the dried sample and 2 μL of 10xGlyco Buffer (New England Biolabs™) were added into 2 mL Eppendorf tube and incubated in the thermomixer at 99 °C for 10 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... 10 µL of a 1000 U of DNase I stock was added to 500 µL of DNase I buffer on cells for 10 minutes or 2 µL of a 5000 U of RNase H stock (NEB M0297S) was added to 500 µL of RNase H buffer on cells for 5 minutes at 45 °C ...
-
bioRxiv - Microbiology 2021Quote: ... DNA fragments located upstream and downstream to the epitope insertion sites were amplified by PCR using the Q5® High-Fidelity 2 × Master Mix (NEB) with relevant primers (Table 1 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The amplicons were analyzed by 1.5% agarose gel electrophoresis with ethidium bromide staining and using a DNA ladder marker (2 log DNA ladder from New England Biolabs, USA). Amplicon bands were observed under UV light ...
-
bioRxiv - Immunology 2021Quote: ... Add 50 μl of 10X NEB Buffer 2 and 375 U (15 μl of 25 U/ μl) of MboI restriction enzyme (NEB, R0147), and digest chromatin for 2 hours at 37°C with rotation ...
-
bioRxiv - Immunology 2020Quote: ... NEBNext® Multiplex Oligos for Illumina® (Index Primers Set 1 and 2) and NEBNext Poly(A) mRNA Magnetic Isolation Module (New England Biolabs). Library quantification was performed by real-time PCR using the KAPA Library Quantification Kit - Illumina Platforms - Complete kit (Universal ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μl of 10 mM MnCl2 and 1-2 μl (400-800 units) of λ PP (New England Biolabs, Ipswich, MA). Untreated lysates received 1-2 μl of water in place of λ PP ...
-
bioRxiv - Genomics 2020Quote: ... and used for PCR amplification of the target region using the Q5® Hot Start High-Fidelity 2× Master Mix (NEB), followed by evaluation of the PCR products by gel electrophoresis and purification with the Qiaquick PCR purification kit (28104 ...
-
bioRxiv - Genomics 2021Quote: ... PCR amplification of the samples was performed using Nextera primers 1 and 2 and NEBNext High fidelity master mix (NEB, M0541S) for 12 cycles as determined by KAPA Real-Time Library Amplification Kit (Peqlab ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μl 10 pM/μl TrAEL-seq adaptor 1 (49) and 1 μl T4 RNA ligase 2 truncated KQ (NEB M0373L). Plugs were then rinsed with 1 ml tris buffer ...
-
bioRxiv - Microbiology 2020Quote: ... HDR editing-specific PCR was performed on 2 μL of samples using the OneTaq polymerase (New England Biolabs, Whitby, ON, Canada) and primers T5a_mut_fwd (5’-AAATAATCTACGGGGCCGGCGGCACAG ...
-
bioRxiv - Biophysics 2022Quote: ... the reaction was diluted to 90 µl and was supplemented with 10 µl DNAse I buffer and 2 µl DNAse I enzyme (NEB #M0303S) and incubated for 15 minutes at 37□ C to degrade the DNA template ...
-
bioRxiv - Developmental Biology 2022Quote: ... equal amount of DNA (∼2 ng) was used as an input for NEB Ultra II DNA library prep kits (NEB #E7645). Number of cycles for amplification of adapter ligated libraries were estimated by the qPCR before final amplification to avoid any bias arising due to PCR amplification and indexing (NEB #E7350) ...
-
bioRxiv - Biochemistry 2022Quote: ... the sample was diluted to 50 μL with ammonium bicarbonate buffer and incubated at 37 °C with 2 μL of PNGase F (New England Biolabs P0705S) diluted 1:100 in ammonium bicarbonate for an additional 7 hours ...
-
bioRxiv - Cell Biology 2022Quote: ... Dephosphorylation of CRL4B took place in a 100 μl reaction mixture containing 86 μl of CRL4B protein (at 0.8 mg/ml) with 2 μl λ-phosphatase (λ-PP) in the presence of 0.1 mM MnCl2 and 1x PMP reaction buffer (NEB). Untagged-CRL4 complexes (4A ...
-
bioRxiv - Cell Biology 2022Quote: ... the sequence encoding amino acids 1-490 was amplified with NdeI and EcoRI overhangs and inserted into a modified backbone based on pSNAP-tag(T7)2 (NEB #N9181S) before a SNAPf-EGFP-6His tag (Budaitis et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... An IFT144 construct lacking the N-terminal β-propeller domain (residues 2–349 inclusive; IFT144ΔNFLAG) was made using the Q5® Site-Directed Mutagenesis Kit (NEB).
-
bioRxiv - Genetics 2022Quote: ... 500 ng of purified PCR products (D2500, Gel Extraction Kit, OMEGA, USA) were denatured and reannealed in NEB buffer 2 (M0302S, NEB, USA): 95 ℃ ...
-
bioRxiv - Microbiology 2022Quote: RNA-free PXO99A genomic DNAs (0.2 μg) were used to construct the DNA libraries using a NEBNext Ultra DNA Library Prep Kit for Illumina (NEB, USA) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... The transformation vector pICU2:Cas9-dsRED containing the Cas9 gene from Streptococcus pyogenes expressed under the promoter of the Arabidopsis Incurvata 2 gene (ICU2, At5g67100) was combined with the gRNA combinations by Gibson assembly (NEB, USA). For RPB1 ...
-
bioRxiv - Plant Biology 2022Quote: ... including the stop codon and (2) the CDS and native promoter region 1024 bp upstream using Phusion High Fidelity DNA polymerase (NEB, USA) and TA-ligated into the entry vector pCR8/GW/TOPO (Thermo ...
-
bioRxiv - Molecular Biology 2023Quote: ... Beads were next resuspended in 1X Thermo Pol Buffer and treated with 2 µL RNA 5’ Pyrophosphohydrolase (New England Biolabs M0356) at 37°C for 1 h to promote decapping of 5’ RNA ends ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The cDNAs were subcloned into vectors through conventional ligation with Ligation high Ver.2 (Toyobo, Japan) or NEBuilder HiFi DNA Assembly (New England Biolabs, MA) according to the manufacturer’s instructions ...
-
bioRxiv - Pathology 2023Quote: ... cDNA then was used as a template for barcoding PCR following ONT’s protocol (SQK-LSK110 with EXP-PBC096) and LongAmp Taq 2× Master Mix (NEB, Ipswich, MA). The barcoded amplicons were bead purified at a 0.8× beads:solution ratio before being pooled by equal volume with libraries from unrelated samples and a library generated from HeLa RNA (ThermoFisher)
-
bioRxiv - Molecular Biology 2022Quote: ... pHAGE lentiviral plasmids encoding the six other HCoV N-EGFP were generated by replacing SARS-CoV-2 N with the respective HCoV N sequences by PCR (New England Biolabs M0492S) and NEBuilder HiFi DNA Assembly (New England Biolabs E2621S) ...
-
bioRxiv - Genomics 2023Quote: Library oligos for the MYC enhancer screen were synthesized by Twist Bioscience and amplified using the NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L), forward primer ...
-
bioRxiv - Genomics 2023Quote: ... thirty 20 μl ePCRs were performed using 400 ng of DNA for each reaction and NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541S) with the following primers ...
-
bioRxiv - Biophysics 2023Quote: ... These plasmids were digested with NotI-HF and XhoI for 2 h at 37°C (R3189, R0146, New England Biolabs, UK) and heat-inactivated for 20 min at 80°C.
-
bioRxiv - Genetics 2023Quote: Library oligos for the prime editing screen were synthesized by Twist Bioscience and amplified using the NEBNext High-Fidelity 2× PCR Master Mix (NEB M0541L) with the forward primer GTGTTTTGAGACTATAAATATCCCTTGGAGAAAAGCCTTGTTT and the reverse primer CTAGTTGGTTTAACGCGTAACTAGATAGAACCGCGGTGTTAGG ...
-
bioRxiv - Biochemistry 2023Quote: ... The mutant and wild-type target RNA were subsequently amplified using either the NEB Luna SARS-CoV-2 RT-qPCR Multiplex Assay Kit (NEB E3019), Luna Probe One-Step RT-qPCR 4X Mix with UDG (NEB M3019 ...
-
bioRxiv - Cell Biology 2022Quote: ... The mutant fragments were amplified by high-fidelity DNA polymerase 2 × Phanta Max Master Mix followed by DpnI (New England BioLabs; R0176S) digestion in 37°C for 1 hour to eliminate the templates ...
-
bioRxiv - Genetics 2023Quote: ... PCR products were analyzed on 2% Agarose gels with 0.5 ng/L Ethidium bromide using a 1kb Plus DNA Ladder (New England BioLabs Cat # N3200S) for size reference ...