Labshake search
Citations for New England Biolabs :
1951 - 2000 of 2000 citations for 6 chloro 4 hydroxyquinoline 3 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... the purified PCR products were ligated with the empty vectors in a molar ratio of 1:4 using T4 DNA ligase (NEB, USA) at 16 °C overnight ...
-
bioRxiv - Neuroscience 2023Quote: ... the coverslips were washed in 2×SSC for 30 minutes for a total of four washes and then stored at 4°C in 2×SSC supplemented with 1:100 Murine RNase inhibitor (New England Biolabs, M0314S) for no longer than 2 weeks prior to imaging.
-
bioRxiv - Genetics 2023Quote: ... 4 µg of DNA in 80 µl reaction were incubated at 37°C for seven minutes and randomly fragmented to 300 bp – 4 kb size products using NEBNext® dsDNA Fragmentase (New England BioLabs) and then cleaned using 0.5x SPRI beads ...
-
bioRxiv - Genomics 2023Quote: ... cells were then pelleted at 500xg for 2 min at 4°C and then resuspended in 200 μl of 1 × T4 DNA ligase buffer (NEB, B0202S) containing 0.2% SDS ...
-
bioRxiv - Genetics 2023Quote: ... After 48 h cells were incubated for 30 min at 37 °C with SNAP-Oregon green (NEB, final concentration 4 µM). Cells were then incubated for 30 min at 37 °C in fresh media to wash off unbound substrate ...
-
bioRxiv - Cancer Biology 2023Quote: ... then incubated for 2 h at 37°C in 100 μl 1x TdT buffer containing 4 μl 10 mM ATP and 1 μl Terminal Transferase (NEB M0315L). Plugs were rinsed with 1 ml Tris buffer (10 mM Tris HCl (pH 8.0)) ...
-
bioRxiv - Microbiology 2023Quote: ... Digestion products were diluted by the addition of 4 mL 1.1× T4 DNA Ligase Reaction Buffer (New England BioLabs® Inc) with 1% Triton X-100 and incubated for 1 h at 37°C ...
-
bioRxiv - Plant Biology 2024Quote: RNA was isolated from leaves 4 and 5 using Trizol and cDNA was synthesized using MuMLV reverse transcriptase (New England Biolabs, Inc.) primed with random hexamers ...
-
bioRxiv - Biophysics 2024Quote: ... The N-glycans of Fc were unified by adding 1 nmol of β1-4 Galactosidase S (New England Biolabs, Tokyo, Japan) per 1 unit of glycan terminus (mixed so that the enzyme solution was 10% of the total reaction solution ...
-
bioRxiv - Biochemistry 2024Quote: The coding sequence of human EIF4EBP1 (NM_004095.4) was amplified from cDNA derived from HepG2 cells using primers containing restriction sites using Q5 polymerase (New England Biolabs, M0491). PCR products were cloned into suitable vectors using restriction digest followed by ligation ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Standard Illumina adapters were ligated using 60 cycles of digestion at 37 °C (2 minutes) and ligation at 16 °C (4 minutes) with 400 U of T4 ligase (New England Biolabs, USA), followed by heat-inactivation at 65 °C (10 minutes) ...
-
bioRxiv - Microbiology 2020Quote: ... PCR protocols entailed an initial phase of 95° C for 3 min using Hot Start Taq polymerase (New England BioLabs Inc., Ipswich, MA, USA), followed by 35 cycles at 50°C and 52°C annealing temperatures for 16S and ITS amplicons respectively ...
-
bioRxiv - Neuroscience 2020Quote: ... Sequencing libraries were generated from a total amount of 3 μg RNA per sample using NEBNext® Ultra™ RNA Library Prep Kit for Illumina® (NEB, USA) following manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2021Quote: ... 500 μl of lysed cells were transferred to a tube containing 4.5 ml of digestion mix (1X NEB 3 buffer, 1% triton X-100) and 100 μl of the lysed cells were transferred to a tube containing 0.9 ml of digestion mix ...
-
bioRxiv - Plant Biology 2022Quote: ... 250 μL 2× lysis buffer (20 mM Tris-HCl, 40 mM Na2EDTA, 1% (w/v) SDS) and 3 μL proteinase K (NEB: P8102S, 20 mg/mL) were added and incubated under agitation at 55°C for 2 h ...
-
bioRxiv - Microbiology 2024Quote: ... 5’-GCT GCG TTC TTC ATC GAT GC-3’) were chosen with barcodes for PCR amplification using Phusion® High-Fidelity PCR Master Mix (New England Biolabs, Ipswich, MA, USA). The PCR products were then mixed at equal density ratios and purified with a Gel extraction kit (QIAGEN ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 100 ng of DNA was cleaved with PstI HF and MseI restrictases in CutSmart® buffer (New England Biolabs; 3 hours at 37°C). P1 and P2 barcoded adapters corresponding to the restriction site of the enzymes were ligated immediately afterwards with T4 ligase (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were resuspended in 50 mL buffer 3 (20mM KPi pH 7.4, 1.2M Sorbitol, 10 mM ribonucleoside vanadyl complex (NEB S1402S, pre-warmed at 65 °C), 0.08mg/ml Zymolyase-20T (Amsbio 326921) ...
-
bioRxiv - Genomics 2022Quote: ... and for the synthesis of the second strand of cDNA was used the Klenow fragment 3’-5’ exo (New England Biolabs Inc., Ipswich, MA, USA), following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... The cloning reaction consists of 25 cycles of 3 min at 37°C for digestion and 4 min at 16°C for ligation combining the restriction enzymes BsaI-HF (New England BioLabs, Ipswich, UK) for level 1 reaction or BpiI (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2019Quote: ... by random priming without denaturation with 4 mg random nonamer oligo (Integrated DNA Technologies, Skoie IL) and 10 units of Klenow (New England Biolabs, Ipswich, MA). Unincorporated dye was removed with Microcon columns (30 kDa MW cutoff ...
-
bioRxiv - Molecular Biology 2020Quote: ... an end-repair mastermix was made by combining 4 μl T4 DNA ligase reaction buffer (New England Biolabs, NEB, Ipswich, Massachusetts, US), 0.5 μl dATP (10mM ...
-
bioRxiv - Molecular Biology 2020Quote: ... an end-repair mastermix was made by combining 4 μl T4 DNA ligase reaction buffer (New England Biolabs, NEB, Ipswich, Massachusetts, US), 0.5 μl dATP (10mM ...
-
bioRxiv - Plant Biology 2021Quote: ... benthamiana IMPa-4 fragment were used for genomic PCR and followed by digestion with BamHI and XhoI (New England Biolabs, Ipswich, MA). The pTRV2 vector (ABRC ...
-
bioRxiv - Neuroscience 2022Quote: ... Supplementary Table 4) from each sample was further processed with the Illumina NEBNext Ultra II Directional RNA Library Prep Kit (NEB #E7760S/L) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... and the library was amplified 4 cycles by PCR using Phusion high-fidelity PCR master mix with HF buffer (New England Biolabs cat. #M0531L). Finally ...
-
bioRxiv - Neuroscience 2022Quote: ... or medium that were pulled down with heparin-agarose (0.5 ml) were denatured and incubated with Arthrobacter ureafaciens sialidase (Nacalai Tesque, 4 milliunits) and/or O-glycosidase (New England BioLabs, 80,000 units), or peptide N-glycanase (PNGase ...
-
bioRxiv - Molecular Biology 2022Quote: ... samples were incubated at 16 °C for 4 h in the presence of 1.15x of T4 ligation buffer (New England Biolabs, catalog no. B0202S) and 100U T4 ligase ...
-
bioRxiv - Microbiology 2024Quote: ... GM16 genomic DNA using primers SA-Reg FWD and SA-Reg REV (Table 4) and polymerase Q5 (New England Biolabs, Massachusetts, USA). The destination plasmid pGW44 [33] was linearized using primers pGW44 FWD and pGW44 REV ...
-
bioRxiv - Cancer Biology 2023Quote: ... mRNA was extracted from homogenized cell lysate by 4 × 250 µL/brain Oligo (dT)25 magnetic beads (New England Biolabs, Cat: S1419S), and immunoprecipitated (IP ...
-
bioRxiv - Genomics 2023Quote: ... Illumina libraries for all 4 isolates were constructed using the NEBNext Ultra II FS DNA Library Prep Kit (New England Biolabs Inc., USA) as per standard protocol and sequenced using the Illumina MiSeq and NextSeq500 platforms (paired end ...
-
bioRxiv - Microbiology 2023Quote: ... followed by 12 cycles of 95°C for 15 seconds and 60°C for 4 min followed by exonuclease I (New England Biolabs, PN M0293S) treatment at 37°C for 30 minutes and 80°C for 15 minutes to remove any unincorporated primers ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was ligated for 4 h in a water bath at 16 °C (30 Weiss Units of T4 DNA Ligase, M0202 New England BioLabs® Inc). 300 μg of Proteinase K was used to reverse the cross-linking overnight at 65°C ...
-
bioRxiv - Biochemistry 2024Quote: ... Qiagen protocol 4 was followed for enzymatic lysis with lysozyme (DOT Scientific catalog #DSL38100) and 20 µL proteinase K (NEB catalog #P8107S). Qiagen protocol 7 was followed for RNA purification including DNase I digestion on-column (Qiagen catalog# 79254) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... cells were washed once with PBS for 3 minutes and subjected to nuclear staining with Hoechst (New England BioLabs; 4082S; diluted 1:5000 in PBS) for 5 minutes ...
-
bioRxiv - Synthetic Biology 2021Quote: ... cells were washed once with PBS for 3 minutes and subjected to nuclear staining with Hoechst (New England BioLabs; 4082S; diluted 1:5000 in PBS) for 5 minutes ...
-
bioRxiv - Genomics 2021Quote: ... The selected DNA fragments were end-repaired and 3’-adenylated with the NEBNext® Ultra™ II End Repair/dA-Tailing Module (New England Biolabs, Ipswich, MA, USA). The DNA was then purified with AMPure XP beads (Beckmann Coulter ...
-
bioRxiv - Biophysics 2023Quote: ... linker (listed in Supplemental Table S6) was ligated to the 3′ end using T4 RNA Ligase 2 truncated KQ (New England Biolabs #M0373, 400 units per sample) in T4 Ligase reaction buffer (New England Biolabs #B0216 ...
-
bioRxiv - Biophysics 2021Quote: ... PfK5ΔL6-MD-SNAP was biotinylated or fluorescently labelled by overnight incubation at 4°C with SNAP-Biotin® or SNAP-Surface® Alex Fluor® 647 (New England BioLabs) with at least a 3:1 molar excess of these labels to PfK5ΔL6-MD-SNAP ...
-
Comprehensive profiling of antibody responses to the human anellome using programmable phage displaybioRxiv - Immunology 2022Quote: 5 μl ligation reactions were set up with a total of 500 ng DNA (vector and insert at a 1:4 molar ratio) and high-concentration T4 DNA ligase (NEB Cat No. M0202T). The ligation mix was packaged using the T7Select Packaging Extract (EMD Millipore ...
-
bioRxiv - Cancer Biology 2019Quote: ... sequences are listed in Supplementary Table 4) and cloned into pGL3-TK-5UTR-BsmBI-Luciferase using BsmBI (New England BioLabs; Whitby, Ontario, Canada). The “Snail 417” UTR insert was generated by PCR using the forward primer TATCGTCTCAACACCGAGCGACCCTGCATAAGCTTGGCGCTGAGCCGGTGGGCG and the reverse primer ATACGTCTCTCTTCCATAGTGGTCGAGGCACTGGGGTCG ...
-
bioRxiv - Pathology 2021Quote: RT-qPCR was also performed on RNA extracted from the 4 dpi lung samples with NEB Luna Universal One-Step RT-qPCR Kit with SYBR-Green (NEB, Ipswich, MA, USA) to quantify the cytokines IL-6 and IFN-β ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 µL ligation mix (2 µL 10x T4 ligase buffer, NEB, 1 µL T4 RNA ligase 2, truncated, NEB, 1 µL Ribolock inhibitor) was added and incubated (1 h ...
-
bioRxiv - Neuroscience 2024Quote: ... Pellets were resuspended in NEB buffer prior to centrifugation at 11,500 rpm for 20 minutes at 4°C on a sucrose gradient (1.6M sucrose in NEB and 0.8M sucrose in NEB). Nuclei-containing pellets were fixed with 0.3% formaldehyde in NEB and rotated at room temperature for 10 minutes ...
-
bioRxiv - Plant Biology 2024Quote: ... Genes of interest were cloned to Gateway™ pENTR™ 4 Dual Selection Vector (A10465) by NEBuilder HiFi DNA Assembly Master Mix (NEB, E2621L) and cloned to a pUC19 expression vector powered by the maize ubiquitin promoter (ZmUBI ...
-
bioRxiv - Genetics 2021Quote: ... 5 μg of MBP-Rif2 or MBP-Rif2-min (see recombinant protein preparation) was incubated for 1 h at 4 °C with amylose resin (New England Biolabs, 50 μl per reaction). The resin with the immobilized MBP-Rif2 variants was washed 5 times with 1 ml wash buffer (50 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Plant Biology 2024Quote: ... when OD600 reached 0.5 for 4 h at 37 °C and then they were purified using amylose resin column (New England Biolabs, for MBP related proteins purification) or Ni-NTA agarose column (Qiagen ...
-
bioRxiv - Biochemistry 2022Quote: ... purified KRAS protein was mixed with GMP-PNP (molar ratio of 10:1 GMP-PNP:KRAS) and calf intestinal alkaline phosphatase (NEB cat# M0290, 3 units per mg of KRAS). The reaction mixture was incubated for 3 hours at room temperature and then purified by size-exclusion chromatography on a 10/300 Superdex 75 GL column (GE Healthcare ...
-
bioRxiv - Cell Biology 2019Quote: ... a linker flanked by AgeI and SacII restriction sites was introduced into pcDNA™4/TO between EcoRI and XhoI restriction sites using Gibson Assembly® (New England Biolabs, Ipswich, MA, USA). The SYFP2 fluorophore was inserted downstream of the linker between SacII and XbaI restriction sites using pSYFP2-C1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... GGGMcm3 (in association with the other Mcm2-7 subunits) was cleaved off the resin with 500 units of 7×His-TEV protease (NEB; rotation overnight at 4°C). The flow-through was collected and applied to 0.4 mL volume Ni-NTA Agarose resin (Qiagen ...