Labshake search
Citations for New England Biolabs :
151 - 200 of 7434 citations for rno mir 129 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... mRNA Magnetic Isolation Module and NEBNext Multiplex Oligos for Illumina (Index Primers Set 1/2/3/4) following the manufacturer’s instructions (New England Biolabs). Quantification and quality checked of libraries was done using an Bioanalyzer 2100 instrument and DNA 7500 kit (Agilent Technologies) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Reverse transcription and subsequent PCR amplification was done with OneTaq RT-PCR Kit (New England Biolabs). Primers ...
-
bioRxiv - Bioengineering 2022Quote: ... RNA was reverse-transcribed and PCR amplified using Luna Universal One-Step RT-PCR Kit (NEB). SARS-CoV-2 replication was assessed by using primers specific to the N mRNA (Forward 5’-CTCTTGTAGATCTGTTCTCTAAACGAAC-3’ ...
-
bioRxiv - Bioengineering 2022Quote: ... 10 μL PCR reactions were set-up using 2 μL 5x HF Buffer (NEB), 0.5 μL 10 mM dNTPs (NEB) ...
-
bioRxiv - Plant Biology 2023Quote: ... PCR amplifications were set up using the Q5 protocol (New England BioLabs, MA, USA), with the previously described plasmid (pEE392 ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR reaction was set up using Q5 polymerase (New England Biolabs, Whitby, Canada) following the manufacturer’s recommendation ...
-
bioRxiv - Microbiology 2020Quote: ... The amplified 1,297 RT-PCR products were digested with MluI (NEB). Amplified DNA products ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... RT-PCRs were conducted using Phusion per the manufacturer’s instructions (NEB) for 25 cycles ...
-
bioRxiv - Neuroscience 2024Quote: ... RT-PCR reactions were performed with Taq polymerase (New England Biolabs) with cDNA diluted to 10 ng/µL ...
-
bioRxiv - Microbiology 2023Quote: ... The thermal cycle of the RT-qPCR machine was set up based on NEB #M3003 instruction manual (NEB, UK). Transcription values (Ct ...
-
bioRxiv - Microbiology 2023Quote: ... The thermal cycle of the RT-qPCR machine was set up based on NEB #M3003 instruction manual (NEB, UK). Transcription values (Ct ...
-
bioRxiv - Cancer Biology 2021Quote: ... Quantitative RT-PCR was performed using Luna Universal One-Step RT-qPCR kit (New England Biolabs, Ipswich, MA, USA) according to manufacturer’s protocol using Agilent Mx3000P instrument ...
-
bioRxiv - Biochemistry 2024Quote: ... Acad11 genotypes were assessed using a three-primer PCR strategy with the 5X Multiplex PCR Mix (NEB) to allow for the simultaneous detection of both wild-type and mutant alleles ...
-
bioRxiv - Molecular Biology 2022Quote: ... Tagmented DNA was PCR amplified using custom i5 and i7 PCR primers and Phusion® High-Fidelity PCR Master Mix with GC Buffer (NEB). PCR conditions were ...
-
bioRxiv - Cancer Biology 2019Quote: ... PCR amplification of the target locus (forward primer: 5’-GGTTCTCAGTGCACGCATTT-3’; reverse primer: 5’-ACAACGATTTTCCTGGCATCT-3’) with Q5 polymerase (NEB), and Sanger sequencing of PCR products by the Keck Biotechnology Resource Laboratory at Yale ...
-
bioRxiv - Cell Biology 2022Quote: ... The 229E Spike cDNA was amplified by PCR with the forward primer: 5’-TTTTTTGCGGCTAGCATGTTCGTGCTGCTGG and the reverse primer: 5’-TTTTTTGCGCTCGAGTCACGCCGGCGCCACCTGGCTGGTTTCGGTCTGGATGTGGATC TTTTCCA using Phusion polymerase (New England Biolabs) according to manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2019Quote: ... and pcDNA4/TO (forward primer 5’ GACACGTGAGAGGGAGTAGAAGCCGCTGATCAGCCTCGACTG 3’ and reverse primer 5’ CAATGGGGCGGAGTTGTTAC 3’) PCR products were assembled using Gibson Assembly (New England Biolabs) [36] ...
-
bioRxiv - Genetics 2020Quote: ... The F1 progeny of the injected animals were selected for the roller phenotype and screened by PCR (forward primer 5’ TTGGAAGTGTTCGGTTACAAAA; reverse primer 5’ AAACTAAAATTGGCACGAAACG; IDT) and NcoI restriction digestion (New England Biolabs). Non-roller ...
-
bioRxiv - Developmental Biology 2019Quote: ... ChIP-seq libraries were prepared using the NEBNext Ultra II library prep kit with the NEB Unique Dual Index primer set kit (New England Biolabs). Samples were sequenced at the Northwestern University NuSeq Core Facility on an Illumina HiSeq 4000 on single-end 50 bp mode ...
-
bioRxiv - Molecular Biology 2019Quote: ... Each of the libraries was labeled by a specific barcode provided in NEBNext Multiplex Oligos for Illumina (Index Primers Set 1) (NEB) and amplified 7 cycles by PCR in the presence of SYBR Green in order to obtain an optimal yield ...
-
bioRxiv - Molecular Biology 2019Quote: ... Each of the libraries was labeled by a specific barcode provided in NEBNext Multiplex Oligos for Illumina (Index Primers Set 1 and 2) (NEB) and amplified 9-13 cycles (depending on initial material amount ...
-
bioRxiv - Molecular Biology 2019Quote: ... Libraries for small RNA sequencing were prepared with 200 ng of RNA using NEBNext Small RNA Library Prep Set with modified adaptors and primers compatible for Illumina (New England Biolabs). Single end sequencing was carried out at the TCGB Resources (UCLA Path and Lab Med ...
-
bioRxiv - Microbiology 2019Quote: ... Samples were prepared using the NEBNext DNA Library Prep Master Mix Set for Illumina for use with End User Supplied Primers and Adapters (New England Biolabs) following manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: Plasmid pNR127.9 was constructed by changing the first rfk-1 stop codon in pNR9.1 from TAG to TGG with primer set 1727/1728 and the Q5 Site-Directed Mutagenesis Kit (New England Biolabs). Similarly ...
-
bioRxiv - Biophysics 2021Quote: ... the corresponding set of specific primers (Table S1) and digestion of the template from the reaction mix with DpnI (New England Biolabs), following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... The library was prepared using the NEBNext Ultra II kit and indexes from the Dual Index Primers Set 2 (all New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... and NEBNext® Multiplex Oligos for Illumina® (Dual Index Primers Set 1) (NEB #E7600) (New England Biolabs, Ipswich, MA). Libraries were pooled and sequenced by the Duke Sequencing and Genomic Technologies Shared Resource on an Illumina NextSeq 500 using the High-Output Kit to produce 75-basepair single-end reads.
-
bioRxiv - Physiology 2022Quote: RNA-sequencing libraries were prepared by depleting eukaryotic ribosomal RNA with the NEBNext rRNA Depletion Kit prior to library synthesis with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina and addition of multiplex oligos using the Unique Dual Index Primer Pairs Set 3 (NEB). Library quality control was performed using Qubit and Bioanalyzer 2100 ...
-
bioRxiv - Systems Biology 2023Quote: ... and used as template for the 2nd PCR where Illumina barcodes were added by NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1 and 2) (New England Biolabs). PCR products were purified using AMPure XP beads (BECKMAN COULTER) ...
-
bioRxiv - Microbiology 2023Quote: ... These PCRs were performed with the specified primer sets (a, c and e or b, d and f) and Q5 High-Fidelity Polymerase (NEB) according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... and amplified using NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs Set 2, New England Biolabs, #E6442). After quality check with the Bioanalyzer High Sensitivity DNA assay (Agilent) ...
-
bioRxiv - Systems Biology 2021Quote: ... NEB_EC2H_Barcode_F: GACTGGAGTTCAGACGTGTGCTCTTCCGATCTAGAACTATTTCCTGGCTGTTACGCG and NEBNext Universal PCR Primer for Illumina (New England Biolabs). The thermocycling parameters were 95 °C for 3 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... To introduce unique barcodes secondary PCR was performed using TrueSeq primers (NEB) (Smola et al ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2uL 10uM uniquely barcoded i7 primer and 25uL PCR master mix (NEB Phusion® High-Fidelity PCR Master Mix with HF Buffer ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2uL 10uM uniquely barcoded i7 primer and 25uL PCR master mix (NEB Phusion® High-Fidelity PCR Master Mix with HF Buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... which was performed with the NEBNext Universal PCR Primer for Illumina (NEB) and indexed primers (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... Total RNAs were used as templates for SYBR green-based one-step reverse-transcriptase quantitative PCR (RT-qPCR) using the NEB Luna One-Step RT-qPCR kit (New England Biolabs). All primers were validated by standard curve analysis and had PCR efficiencies ranging from 90-110% ...
-
bioRxiv - Pathology 2021Quote: Reverse-transcription polymerase chain reaction (RT-PCR) was performed using the Luna Universal Probe One-Step RT-qPCR kit (NEB). Two gene targets were used for SARS-CoV-2 RNA detection ...
-
bioRxiv - Genetics 2022Quote: The detection of aberrant Scyl1 transcripts was performed by RT-PCR using primers designed to amplify sequences between exon 2 to exon 5 (RT-Scyl1_F21 5’-CGCAGTGTCCATCTTCGTGTA-3’ and RT-Scyl1_R51 5’-CCCGGCAGTTCTGCAGGAA-3’) following the OneTaq One-Step RT-PCR Kit (New England Biolabs, E5315S) procedure ...
-
bioRxiv - Immunology 2024Quote: ... Gene expression levels were quantified by reverse transcription quantitative PCR (RT-qPCR) using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs), and being conducted on a QuantStudio 3 Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Microbiology 2021Quote: ... Official CDC SARS-CoV-2 N1 gene primers and TaqMan probe set were used [58] with the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs):
-
bioRxiv - Cell Biology 2020Quote: cDNA was amplified with primers listed in Primers and sequences section of methods with Q5® High-Fidelity DNA Polymerase PCR System (NEB). PCR conditions ...
-
bioRxiv - Genomics 2021Quote: ... Amplification reactions from this cDNA were performed with the 5’ PCR primer and a reverse primer corresponding to the target sequence using LongAmp Taq polymerase (NEB M0287). The PCR products were sequenced and the junction between the ligated oligo revealed the start sites.
-
bioRxiv - Genetics 2020Quote: RT-PCR reactions were performed with Phusion High-Fidelity DNA Polymerase (NEB) according to manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2022Quote: ... reverse transcribed and amplified with OneTaq one-step RT-PCR kit (NEB) for verification by Sanger sequencing.
-
bioRxiv - Genomics 2024Quote: RT-PCR was conducted using Quick-Load Taq 2X Master Mix (NEB). For molecular cloning applications Q5 High-Fidelity DNA polymerase (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... All RT-PCR reactions were performed using Q5 polymerase (New England Biolabs) under the following cycling conditions on a Bio-Rad T100 thermal cycler ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The cDNA was then used to conduct RT-PCRs with Phusion (NEB). Primers are provided in Data S1.
-
bioRxiv - Cell Biology 2020Quote: ... libraries were prepared using the NEB Ultra II Library Preparation Kit and NEBNext® Multiplex Oligos for Illumina (Dual Index Primers Set 1) (New England BioLabs). The generation of the libraries followed manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... the ARTIC nCoV-2019 V3 Primer set (IDT) and the Q5 Hot Start High-Fidelity 2X Master Mix (NEB, Cat#M0494S) were used with modified manufacturer’s instructions ...