Labshake search
Citations for New England Biolabs :
151 - 200 of 2037 citations for n4 Benzoyl 5 methyldeoxycytidine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... or exonuclease III (NEB, 5 units) were performed on 2 – 3 μg of DNA extracted from virus particles for 1 h at 37 °C ...
-
bioRxiv - Microbiology 2022Quote: ... coli NEB® 5-alpha (NEB) according to the instructions of the manufacturer ...
-
bioRxiv - Systems Biology 2023Quote: ... 5 μL Q5 Reaction Buffer (NEB), 5 μL 50% glycerol ...
-
bioRxiv - Systems Biology 2023Quote: ... 5 μL Q5 Reaction Buffer (NEB), 5 μL 50% glycerol ...
-
bioRxiv - Systems Biology 2023Quote: ... 5 μL Q5 Reaction Buffer (NEB), 0.5 μL 10 mM dNTPs ...
-
bioRxiv - Systems Biology 2023Quote: ... 5 μL High GC Enhancer (NEB), 0.5 μL 10 mM dNTPs ...
-
bioRxiv - Systems Biology 2023Quote: ... 5 μL Q5 Reaction Buffer (NEB), 5 μL High GC Enhancer (NEB) ...
-
bioRxiv - Immunology 2023Quote: ... 5 uL 5X Phusion Buffer (NEB), 10 uL 1M Trehalose (Life Sciences Advanced Technologies) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µL 5′deadenylase (NEB #M0331S), 1 µL of RiboLock (ThermoFisher #EO0381 ...
-
bioRxiv - Microbiology 2024Quote: ... 5 μM Mth RNA ligase (NEB), 1 x adenylation buffer (NEB) ...
-
bioRxiv - Molecular Biology 2024Quote: ... NEB 5-alpha competent E.coli (NEB) were transformed by ligated productions using manufacturer’s instructions ...
-
bioRxiv - Biophysics 2024Quote: ... 5 units DNA Pol I (NEB) with water in a total volume of 2x 20 μL ...
-
bioRxiv - Genomics 2024Quote: 5-alpha competent cells (NEB C2987H)
-
bioRxiv - Biochemistry 2024Quote: ... 1 µL 5′-deadenylase (NEB, M0331S) was added into each ligation mixture by incubation at 30 °C for 1hour followed by adding 1 µL RecJf (NEB ...
-
bioRxiv - Microbiology 2024Quote: ... coli NEB-5-alpha (NEB C2987) was used for plasmid cloning ...
-
bioRxiv - Genomics 2024Quote: ... 5 μl 10x rCutSmart buffer (NEB) in a total volume of 50 μl and incubated for 15 min at 65 °C ...
-
bioRxiv - Biophysics 2024Quote: ... NEB 5-ɑ (New England Biolabs) and BL21 (DE3 ...
-
bioRxiv - Cell Biology 2024Quote: ... or NEB 5-alpha HE (NEB) E ...
-
bioRxiv - Genetics 2024Quote: ... 5 μl proteinase K (NEB, P8107) was added and the sample was mixed by pipetting ...
-
bioRxiv - Molecular Biology 2021Quote: An RNA oligonucleotide (5’-GGCATGTGATTGGTGGGTC) was 5’ labelled with gamma 32P ATP by T4 Polynucleotide Kinase (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: ... 5% CO2 -balanced complete cell culture medium with 5 μM SNAP-Surface Alexa Fluor 647 (NEB, S9136S), for 15 minutes at 37°C ...
-
bioRxiv - Neuroscience 2022Quote: ... or 120 μM m7G(5’)ppp(5’)G RNA Cap Structure Analog (M7; New England BioLabs #S1404S) was used ...
-
bioRxiv - Genomics 2024Quote: ... the 5’-end of nascent RNAs was decapped on-beads in RNA 5’ Pyrophosphorylase mix (NEB, M0356S) at 37 °C for 45 min ...
-
bioRxiv - Synthetic Biology 2024Quote: G(5’)ppp(5’)A RNA Cap Structure Analog (New England Biolabs Japan Inc., Tokyo, Japan, #S1406)
-
bioRxiv - Microbiology 2024Quote: ... the RNA was ligated to the 5′-universal RNA adapter (5′GAUAUGCGCGAAUUCCUGUAGAACGAACACUAGAAGAAA3′) using T4 RNA ligase (NEB). After extraction with 25:24:1 phenol/chloroform/isoamyl alcohol and ethanol precipitation ...
-
bioRxiv - Genetics 2022Quote: ... 5 µL of each reaction was combined with 5 µL Phusion Hot Start Flex 2x Master Mix (NEB) and sequences were extended (95 °C 3 min ...
-
bioRxiv - Microbiology 2020Quote: ... 5′-preadenylated oligos oHR546-551 were then ligated to the cDNA using 5′ App DNA/RNA ligase (NEB). Amplification and barcoding PCR was then performed with oligos that annealed to the TSA5 and TSA7 sequences and added i5/i7 and P5/P7 sequences ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 mM DTT) and the 5’-ends were phosphorylated with 25 units of T4 Polynucleotide Kinase (NEB #M0201) for 15 min at 37 °C while shaking in a thermomixer at 1000 rpm for an interval of 15 sec every 3 min ...
-
Competition co-immunoprecipitation reveals interactors of the chloroplast CPN60 chaperonin machinerybioRxiv - Molecular Biology 2023Quote: ... with oligos 5’-GGTGGTTGCTCTTCCAACGCTGACGCTAAGGAGATTGTG-3’ and 5-GGTGGCATATGTTAGATGGTCATGCCGGAGG-3’ and cloned with SapI and NdeI into Tyb21 (NEB), giving pFW38 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Dephosphorylation of the 5’-triphosphate pre-tRNA was done using 5 units QuickCIP (New England Biolabs, cat#M0525S) for 30 minutes at 37°C in 1X rCutSmart Buffer (New England Biolabs ...
-
bioRxiv - Neuroscience 2024Quote: ... PCR amplification (primers 5’ GCTTGATTTAGGTGACACTATAGAATAC, 5’ ACTCCCGGGTTAAGCGGTACGGTTGTACAGG) was performed using Phusion High Fidelity DNA polymerase (New England Biolabs) using pCS2 TeNT-LC-GFP as a template (a gift from Martin Meyer) ...
-
bioRxiv - Genomics 2024Quote: ... Nuclei were digested using 800 U of BamHI (for 5’-5’ loop) or BglII (for junction loop) (NEB) on a shaker overnight at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 7.5 µl m7G(5′)ppp(5′)G RNA Cap Structure Analog (10 μmol) (New England BioLabs, Ipswich, MA), 2 µg linearized DNA ...
-
bioRxiv - Molecular Biology 2024Quote: A 2-fold excess of either m7G(5’)ppp(5’)G RNA Cap Structure Analog (New England Biolabs) or chemically synthesized cap4 hexa-nucleotide (see cap4 synthesis below ...
-
bioRxiv - Genetics 2021Quote: ... 10μl Klenow (3’-5’ exo-) (M0202L, NEB), and 420μl H2O with 1 hr incubation at room temperature and then subjected to proximity ligation by adding 200μl 5× ligation buffer (B6058S ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... .5 uL of Phusion polymerase (NEB M0530S), and enough to water to total the reaction volume at 50 uL ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 µL ExoI (20 U/µL, NEB), 7 µL HinFI (10U/µL ...
-
bioRxiv - Bioengineering 2022Quote: ... 5 μL of 5x Phusion buffer (NEB) and 14.25 μL of nuclease-free water ...
-
bioRxiv - Genomics 2022Quote: ... and 1 μl 5’deadenylase (NEB, M0331) into the 20 μl ligation reaction for incubation with 30 minutes at 30°C and 3 minutes at 65°C to inactivate the enzymes followed by column purification (Zymo Research ...
-
bioRxiv - Genomics 2020Quote: ... 5 μL of Quick T4 Ligase (NEB) in 1X Quick Ligation buffer (NEB) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5 U Antarctic phosphatase (New England BioLabs) and labeled internal standards were added ([15N2]-cadC 0.04301 pmol ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 µL 32mM S-Adenosyl methionine (NEB) (final concentration 0.8 mM) ...
-
bioRxiv - Cell Biology 2020Quote: ... protein tyrosine phosphatase (PTP, 5 unit; NEB), or sodium orthovanadate (Na3VO4 ...
-
bioRxiv - Biochemistry 2020Quote: ... Klenow 3’ to 5’ exo (NEB: M0212) and Biotin-11-dUTP (40 μM ...
-
Insights into the secondary structural ensembles of the full SARS-CoV-2 RNA genome in infected cellsbioRxiv - Biochemistry 2021Quote: ... 1 μl 5′ deadenylase (New England Biolabs) and 1 μl RNaseOUT ...
-
bioRxiv - Microbiology 2020Quote: ... 5 Us of exo(-) Klenow Fragment (NEB), 200 pmol of NNSR-2 Primer for 30 min at 37°C ...
-
bioRxiv - Genomics 2020Quote: ... and 5 μl Large (Klenow) fragment (NEB) to the DNA at R.T ...
-
bioRxiv - Immunology 2022Quote: ... containing 5 U murine RNase Inhibitor (NEB) using a FACSAriaIII instrument (BD) ...
-
bioRxiv - Microbiology 2020Quote: ... 5 units of restriction enzyme BsaJI (NEB) was directly mixed with 300ng of DNA ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and 5× Q5 High GC Enhancer (NEB). PCR thermocycling conditions were 98 °C during 5 s ...