Labshake search
Citations for New England Biolabs :
151 - 200 of 1220 citations for Zika Virus DIII Envelope Protein Asian strain since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2022Quote: ... coli strains: NEB 5-alpha (NEB C2987, not authenticated), BL21-AI (ThermoFisher C607003 ...
-
bioRxiv - Biochemistry 2020Quote: ... coli strain T7 Express (New England Biolabs, Ipswich, USA) at 37 °C in 5 mL LB medium containing 25 μg mL−1 kanamycin by induction with 1 mM IPTG for 3 hours ...
-
bioRxiv - Biochemistry 2020Quote: ... coli strain T7 Express (New England Biolabs, Ipswich, USA) as described in section “Proteolytic inhibition assays” ...
-
bioRxiv - Bioengineering 2019Quote: ... coli strain NEB5α (New England Biolabs, Ipswich, MA, USA) was grown in Luria−Bertani (LB ...
-
bioRxiv - Biochemistry 2020Quote: ... E.coli BL21 (DE3) strain (New England BioLabs, Cat#C2527) was used for overexpression of xlGeminin and the N-terminal residues (1-170 ...
-
bioRxiv - Biochemistry 2020Quote: ... E.coli T7 Express strain (New England BioLabs, Cat#C2566) was used for overexpression of LacI and M.HpaII ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The NEB® DH10B strain (New England Biolabs, #C3019H) was used to assemble and amplify the constructs ...
-
bioRxiv - Biochemistry 2021Quote: ... coli strain NEB Express C2566 cells (New England Biolabs) carrying the pRare2 ...
-
bioRxiv - Biochemistry 2019Quote: Plasmids were used to transformed E.coli strain C2566 (NEB) protease-deficient and carrying pRARE plasmid (Novagen) ...
-
bioRxiv - Biochemistry 2020Quote: ... coli strain T7 Express (New England Biolabs, Ipswich, USA) in 2 L 25 μg mL−1 kanamycin-containing LB medium by induction with 1 mM isopropyl-β-D-thiogalactoside (IPTG) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... or dam+/dcm+ strain DH5-alpha Turbo (NEB C2984) to produce unmethylated or methylated plasmids ...
-
bioRxiv - Microbiology 2021Quote: ... Isogenic 042 mutants and laboratory strain ER2523 (NEB express) shown in Table 1 were used to obtain preliminary information on mode of action of hits ...
-
bioRxiv - Molecular Biology 2022Quote: ... coli expression strain (New England Biolabs, Ipswich, MA, USA). Cell cultivation and expression of CPs as well as cell disruption conditions were the same as previously described for cocksfoot mottle virus and rice yellow mottle virus [52] ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The E.coli strain BL21(DE3) was obtained from NEB, all other strains were provided by the Gonzales lab.
-
bioRxiv - Synthetic Biology 2023Quote: ... Escherichia coli strains used were DH5α (NEB cat C2987H), E ...
-
bioRxiv - Microbiology 2023Quote: ... Strains of Escherichia coli NEB Stable (New England Biolabs) or Rossetta (DE3 ...
-
bioRxiv - Biochemistry 2023Quote: ... coli strains BL21(DE3) (New England Biolabs, ref. C2527I) were grown in LB medium containing kanamycin (50 µg/mL ...
-
Metabolomics reveals nucleoside analogs for regulating mucosal-associated invariant T cell responsesbioRxiv - Immunology 2023Quote: ... Escherichia coli (E. coli strain BL21, New England BioLabs) and Listeria monocytogenes (L ...
-
bioRxiv - Microbiology 2023Quote: ... coli strains following the chemical transformation protocol from NEB for functional characterization ...
-
bioRxiv - Bioengineering 2023Quote: ... coli strains: NEB 5-alpha (NEB, C2987; not authenticated), BL21-AI (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2024Quote: Escherichia coli (E. coli) strains such as DH5α (NEB), BL21 DE3 (NEB) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The cDNA was then used as template to amplify the envelope gene using High Fidelity Phusion DNA Polymerase (New England Biolabs). Nested PCRs were performed ...
-
bioRxiv - Immunology 2020Quote: ... into cDNA which was used in two-round nested PCR for amplification of envelope gene using High Fidelity Phusion DNA Polymerase (New England Biolabs). The envelope amplicons were purified ...
-
bioRxiv - Immunology 2020Quote: ... into cDNA which was used in two-round nested PCR for amplification of envelope gene using High Fidelity Phusion DNA Polymerase (New England Biolabs). First round primers consisted of forward primer VIF2 (5’ – GGGTTTATTACAGAGACAGCAGAG – 3’ ...
-
bioRxiv - Microbiology 2020Quote: ... into cDNA which was used in two-round nested PCR for amplification of envelope gene using High Fidelity Phusion DNA Polymerase (New England Biolabs). The envelope amplicons were purified ...
-
bioRxiv - Cell Biology 2022Quote: Cytokinetic furrowing rate measurements for both the P0 cell and the AB cell were taken relative to nuclear envelope breakdown (NEB). For all analyses ...
-
bioRxiv - Molecular Biology 2021Quote: All eight gene segments of the isolated H6N1 virus were amplified (NEB), purified (Omega ...
-
bioRxiv - Bioengineering 2020Quote: ... coli DH10B strain (NEB #C3019 New England Biolabs, Ipswich, MA) using PureLink Quick Plasmid Miniprep Kit (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: KCM competent bacteria (Escherichia coli strain K12 CJ236, NEB, E4141) were transformed with 3Cs multiplex template plasmid template by mixing 100 ng of DNA with 2 µl of 5x KCM buffer (0.5M KCl ...
-
bioRxiv - Microbiology 2019Quote: ... coli strains NEB 5-alpha F’lq (New England Biolabs, US) and MC1061 with plasmid pKD46 which carries ARA-inducible Red recombination system24 ...
-
bioRxiv - Biophysics 2022Quote: ... Toxicity-resistant strains such as NEB 5-alpha F’Iq (NEB) and ABLE K (Agilent ...
-
bioRxiv - Biochemistry 2022Quote: ... coli strain NEB 10-β competent cells (New England Biolabs) and plated on LB agar containing 50 μg/mL kanamycin ...
-
bioRxiv - Microbiology 2022Quote: ... a phage counterselection strain consisting of dh10b (NEB, Intact Genomics) containing a “counterselection” Cas13a vector (pBA691 for soc or pBA778 for dnap ...
-
bioRxiv - Microbiology 2022Quote: ... a phage editing strain consisting of dh10b (NEB, Intact Genomics) containing a homologous recombination vector (pBA787-pBA792 ...
-
bioRxiv - Immunology 2020Quote: ... and on the Sprague Dawley (SD) strain (rats) (Hera Biolabs) were obtained from vendor and breed in the Division of Laboratory Animal Resources (DLAR ...
-
bioRxiv - Microbiology 2021Quote: ... coli BL21(DE3) cells (T7 Expression strain, New England Biolabs), expressed from a pET28b plasmid ...
-
bioRxiv - Microbiology 2021Quote: ... All assays were done in Escherichia coli (strain: NEB Turbo) following the same plasmid protection assay described previously ...
-
bioRxiv - Microbiology 2020Quote: ... coli cloning strains such as NEB-5a (New England Biolabs) or BH10c,48 with antibiotics added at the following concentrations ...
-
bioRxiv - Microbiology 2022Quote: Escherichia coli strain NEB Stable (New England Biolabs, Ipswich, MA), Pseudomonas aeruginosa strains PA01 and PA14 (generous gift from Dr ...
-
bioRxiv - Biochemistry 2023Quote: ... coli strain SHuffle T7 (New England Biolabs Inc., Massachusetts, USA) and plated on LB agar containing 30 μg/mL kanamycin and 2% glucose ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Coli BL21(DE3) strain (purchased from New England Biolab, NEB), BL21Marioentte (purchased from Addgene ...
-
bioRxiv - Biophysics 2023Quote: We prepared chemically competent cells using NEBTurbo strain (NEB, C2984I) with E ...
-
bioRxiv - Biochemistry 2023Quote: ... coli BL21 strain resistant to phage T1 (New England Biolabs) harboring the pRARE2 plasmid and plated onto LB+Agar plates supplemented with kanamycin (Kan ...
-
bioRxiv - Microbiology 2023Quote: ... Strains used were: Escherichia coli T7 Shuffle (New England Biolabs) to express Rv0365c ...
-
bioRxiv - Microbiology 2024Quote: ... the only exception is the strain NEB5alpha (NEB reference #c2992) used for cloning purposes ...
-
bioRxiv - Microbiology 2024Quote: ... Competent strains of Escherichia coli DH5-α (New England Biolabs), used for DNA cloning and plasmid propagation ...
-
bioRxiv - Microbiology 2024Quote: ... coli strain carrying the plasmid (Monarch Mini-Prep kit, NEB) and transformed it into electrocompetent K ...
-
bioRxiv - Cell Biology 2020Quote: ... a chm7Δapq12Δ (CPL1323) strain was transformed with StuI (New England BioLabs linearized pDT30 ...
-
bioRxiv - Molecular Biology 2019Quote: ... coli strains BL21-CodonPlus-RP or Lemo21(DE3, New England Biolabs). Bacterial lysates were prepared as previously described(48 ...
-
bioRxiv - Bioengineering 2020Quote: ... reesei strain by peptide N-glycosidase F (PNGase F, NEB, P0704) (Wang et al ...