Labshake search
Citations for New England Biolabs :
151 - 200 of 986 citations for Recombinant Human X Linked Inhibitor of Apoptosis AVI tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... PCR confirmation of endogenously tagged ATR cell lines was performed using NEB Taq DNA polymerase (NEB) as per the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR was performed with Nextera-tagged primers under standard Phusion or Q5 Polymerase (New England Biolabs). PCR primers used in this study can be found in Supplementary Table 3 ...
-
bioRxiv - Biochemistry 2022Quote: ... the refolded 6×His-tagged precursors were treated with enterokinase (New England Biolabs, Ipswich, MA, USA) to remove their N-terminal 6×His-tag according to our previous procedure [3,18] and purified by HPLC using an analytical C18 reverse-phase column (Zorbax 300SB-C18 ...
-
bioRxiv - Cell Biology 2021Quote: ... # P0708S) and the presence of O-linked sugars was assessed by combined treatment with O-glycosidase (NEB #P0733S) and α2-3,6,8 neuraminidase (NEB #P0720S) ...
-
bioRxiv - Immunology 2019Quote: ... the gene fragment and the linearized vector were linked by T4 DNA ligase (New England Biolabs, MA, USA). Subsequently ...
-
bioRxiv - Biochemistry 2023Quote: Removal of N-linked oligosaccharides in mini-procollagens was performed with PNGase F (New England BioLabs, glycerol-free). Ten micrograms of mini-procollagens were first denatured at 100 °C for 10 min in Glycoprotein Denaturing Buffer provided with the enzyme ...
-
bioRxiv - Microbiology 2023Quote: ... Cross-linked DNA was digested using 400 U of EcoRI-HF® (R3101 New England BioLabs® Inc) overnight at 37 °C and the enzyme was inactivated with 1% SDS at 65 °C for 20 min ...
-
bioRxiv - Neuroscience 2019Quote: ... pCAV-FLExloxP-Flp was incubated with recombinant Cre recombinase (New England Biolabs) and then transformed into DHα bacteria ...
-
bioRxiv - Neuroscience 2022Quote: ... the recombinant proteins were purified by amylose resin (#E8022S, New England Biolabs) according the manual instructions ...
-
bioRxiv - Synthetic Biology 2021Quote: The recombinant CBX8-CD was expressed in BL21 (DE3) (New England Biolabs) Escherichia coli cells ...
-
bioRxiv - Biophysics 2021Quote: ... Recombinant M-MuLV reverse transcriptase from the ProtoScript® II kit (NEB) was used to synthesize first strand cDNA from the annealed primer-MS2 RNA mix ...
-
bioRxiv - Cell Biology 2020Quote: Recombinant GFP-fusion proteins were purified from BL21(DE3) cells (NEB, # C2527H) using an N-terminal H6-tag ...
-
bioRxiv - Biochemistry 2022Quote: The recombinant Lili-Mips were treated with PNGase F (New England Biolabs) to remove the N-linked oligosaccharides ...
-
bioRxiv - Microbiology 2023Quote: ... Recombinant vectors were generated using HiFi DNA Assembly Cloning Kit (NEB E5520). During cloning procedures ...
-
bioRxiv - Microbiology 2023Quote: ... Recombinant vectors were constructed using HiFi DNA Assembly Cloning Kit (NEB E5520). electroporation (device) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Murine RNAse Inhibitor (NEB), Complete Protease Inhibitor (Pierce ...
-
bioRxiv - Genomics 2020Quote: RNase inhibitors (NEB Murine)
-
bioRxiv - Physiology 2020Quote: ... murine RNase inhibitor (NEB), 1% (w/v ...
-
bioRxiv - Bioengineering 2021Quote: ... murine RNase inhibitor (NEB),100 mM DTT ...
-
bioRxiv - Molecular Biology 2022Quote: ... Murine RNAse Inhibitor (NEB), Complete Protease Inhibitor (Pierce ...
-
bioRxiv - Biochemistry 2021Quote: ... RNase inhibitor Murine (NEB) 2 units/µl ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNAse inhibitor (NEB, M0307L) and random primers (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... RNAse inhibitor (NEB MO314L) was added to the homogenization buffer (0.32 M sucrose ...
-
bioRxiv - Bioengineering 2020Quote: ... RNase Inhibitor (NEB, Murine) was also added at concentration of 2 U/μl before heating ...
-
bioRxiv - Genomics 2020Quote: RNase inhibitor (NEB Murine)
-
bioRxiv - Molecular Biology 2023Quote: ... RNase inhibitor (NEB, M0307L), dNTPs (GE ...
-
bioRxiv - Molecular Biology 2021Quote: ... ligated samples were decross-linked and subjected to a second round of digestion using the restriction enzyme CviQI (NEB). Digested samples were then ligated using T4 DNA ligase and purified before being used as template for inverse PCR ...
-
bioRxiv - Microbiology 2022Quote: ... and the PCR product was linked with pBOMBL::L2 linearized by EagI and KpnI using HiFi assembly system (NEB). The HiFi products were transformed into NEB10β competent cells (NEB ...
-
bioRxiv - Developmental Biology 2023Quote: ... and ligation of DNA ends between the cross-linked DNA fragments was performed in T4 ligation buffer (NEB, B0202), ATP (NEB ...
-
bioRxiv - Developmental Biology 2021Quote: ... and amplified/tagged in two steps using NEBnext High-Fidelity 2x PCR master mix (New England Biolabs). Amplified DNA was purified twice with 1.8 volumes of NucleoMag NGS Clean-up and Size Select beads (Macherey Nagel) ...
-
bioRxiv - Biophysics 2020Quote: mNG-tagged ADRβ2 and EGFR were generating by cloning into the pSNAPf-ADRβ2 backbone (New England Biolabs). mNG was amplified by PCR from mNG-C1 and placed between the EcoRI and SbfI sites of pSNAPf-ADRβ2 (replacing the SNAP tag ...
-
bioRxiv - Cancer Biology 2021Quote: ... Digests with 6 x loading dye (NEB) were run on a 1 % agarose gel at 100 V for 1 h ...
-
bioRxiv - Biochemistry 2019Quote: ... and 1 X PK buffer (NEB, B6022) containing 50 mM Tris ...
-
bioRxiv - Cancer Biology 2021Quote: ... Digest with 6 x loading dye (NEB) was run on a 1 % agarose gel at 100 V for 1 h ...
-
bioRxiv - Molecular Biology 2019Quote: ... or without 350 units of recombinant GSK3β (rabbit skeletal muscle) (New England BioLabs) and 1X hot kinase buffer (50mM Tris ...
-
bioRxiv - Cell Biology 2019Quote: ... Recombinant MBP-Megator fragments were purified with amylose magnetic beads (New England Biolabs) and eluted in Column Buffer supplemented with 10mM Maltose ...
-
bioRxiv - Microbiology 2022Quote: ... Recombinant proteins were affinity-purified using amylose resin using the manufacturer’s protocol (NEB) and eluted with 20 mM maltose ...
-
bioRxiv - Molecular Biology 2019Quote: ... 15μL of myc-eIF6-bound beads were incubated with/without recombinant GSK3β (NEB) and suspended in cold kinase buffer and incubated at 30°C for 30 minutes ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 mM CaCl2) at room temperature in the presence of recombinant enteropeptidase (NEB) at 13 U enzyme per mg TMPRSS2 zymogen ...
-
bioRxiv - Molecular Biology 2021Quote: ... The recombinant protein was sequentially purified using an amylose column (New England Biolabs) followed by a nickel-nitrilotriacetic acid column (Qiagen ...
-
bioRxiv - Genomics 2024Quote: ... 200 µg/mL molecular biology grade recombinant albumin (rAlbumin) (New England Biolabs B9200S), 0.8 U/µL RiboLock RNase inhibitor (Thermo Fisher Scientific EO0384) ...
-
bioRxiv - Microbiology 2022Quote: ... single-stranded adaptors (5’-Phos – ATCCACAACAACTCTCCTCCTC – 3’) were linked to the AdSDV genome segments using T4 RNA ligase I (New England Biolabs). Using the reverse adaptor primer paired with another primer ...
-
bioRxiv - Biochemistry 2021Quote: The α-(1,2)-Galf-containing N-linked glycans were released from 1 mg Transglucosidase L “Amano” (Amano) by using PNGase F (New England Biolabs) under denaturing conditions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... the coding sequence of mCherry and eGFP sequence were linked into the pminiTol2 plasmid with a Gibson cloning kit (New England Biolabs) to generate pmini-eGFP-Lefty-Gdf1/3-like-mCherry construct ...
-
bioRxiv - Immunology 2024Quote: N-linked glycans were enzymatically released from purified mouse THP using PNGase-F kit (catalog no P0709S, New England Biolabs). N-glycans were then purified from the reaction mixture containing denaturing buffer and de-N-glycosylated proteins by solid phase extraction method using Sep-Pak C18 (1 cc Vac-cartridges ...
-
bioRxiv - Bioengineering 2024Quote: ... This fragment was cloned into a lentiviral expression plasmid we have previously described (31) encoding the Notch1 core linked to the tTA transcription factor using NEBuilder HiFi DNA Assembly (New England Biolabs). The resultant plasmid encoded constitutive expression of CII-synNotch receptor from an EF1α promoter and production of the puromycin N-acetyl-transferase transgene via the constitutive PGK promoter for antibiotic selection ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The tagged pore variant plasmids were constructed by Gibson assembly using NEBuilder HiFi DNA Assembly Master Mix (NEB), where the variant encapsulin genes were individually amplified by PCR from the untagged pore variant plasmids ...
-
bioRxiv - Cell Biology 2022Quote: ... FLAG-tagged GPI-anchored PROM1- EX1 was generated by the DNA assembly method (#E2621, NEB, Ipswich, MA, USA). The GPI- anchor signal sequence from pCAG:GPI-GFP (#32601 ...
-
bioRxiv - Cell Biology 2020Quote: ... The Myc-tagged Nix-S212A and Nix-S212D were generated using a Q5 mutagenesis kit (New England Biolabs). The lentiviral shNix (Addgene #100770 ...
-
bioRxiv - Biochemistry 2021Quote: ... His tagged proteins were eluted with lysis buffer containing 400mM imidazole and bound immediately to amylose resin (NEB) for 1hr ...